Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434891799:

Variant ID: vg0434891799 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34891799
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.05, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTTGAAAATGACACAGTTGGACATGGCCCATGGACAAGTGGACTTTGACACAGATTTGTGTTGCAATATTCGGCAAACATAGCTAGCTTACTGTAAAT[G/C]
TGTAATAAATCATATCGATTTACTTATAGTCCGTATGATCGTCGCCGAGGTCTGCCGTGACGACGTCGACGAGGAAGTCGAAGAGATCGGTGTTCTGCAC

Reverse complement sequence

GTGCAGAACACCGATCTCTTCGACTTCCTCGTCGACGTCGTCACGGCAGACCTCGGCGACGATCATACGGACTATAAGTAAATCGATATGATTTATTACA[C/G]
ATTTACAGTAAGCTAGCTATGTTTGCCGAATATTGCAACACAAATCTGTGTCAAAGTCCACTTGTCCATGGGCCATGTCCAACTGTGTCATTTTCAAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.10%	3.80%	0.11%	0.00%	NA
All Indica	2759	98.60%	1.30%	0.11%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	62.10%	37.90%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.20%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	66.70%	33.30%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434891799	G -> C	LOC_Os04g58690.1	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:91.722; most accessible tissue: Zhenshan97 root, score: 96.68	N	N	N	N
vg0434891799	G -> C	LOC_Os04g58690.2	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:91.722; most accessible tissue: Zhenshan97 root, score: 96.68	N	N	N	N
vg0434891799	G -> C	LOC_Os04g58690.3	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:91.722; most accessible tissue: Zhenshan97 root, score: 96.68	N	N	N	N
vg0434891799	G -> C	LOC_Os04g58690.5	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:91.722; most accessible tissue: Zhenshan97 root, score: 96.68	N	N	N	N
vg0434891799	G -> C	LOC_Os04g58690.6	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:91.722; most accessible tissue: Zhenshan97 root, score: 96.68	N	N	N	N
vg0434891799	G -> C	LOC_Os04g58690.4	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:91.722; most accessible tissue: Zhenshan97 root, score: 96.68	N	N	N	N
vg0434891799	G -> C	LOC_Os04g58680.1	downstream_gene_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:91.722; most accessible tissue: Zhenshan97 root, score: 96.68	N	N	N	N
vg0434891799	G -> C	LOC_Os04g58650-LOC_Os04g58680	intergenic_region ; MODIFIER	silent_mutation	Average:91.722; most accessible tissue: Zhenshan97 root, score: 96.68	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0434891799	G	C	0.04	0.07	0.06	0.03	0.05	0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434891799	NA	2.85E-07	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	7.58E-06	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	2.68E-07	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	3.62E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	7.05E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	1.79E-07	2.51E-17	mr1158	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	7.60E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	5.95E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	7.53E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	3.11E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	3.67E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434891799	NA	6.02E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251