| Variant ID: vg0434853783 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 34853783 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )
TGTGGACTTCTCGTTTGGATCTTCTAGGCCCAATGATACTAGAGTTATGGGTAGTGCTCTGTATTGATGCCGTAACATTCCTCCCTCCTTGAGTTTCAGC[C/T]
TGTCCCCAGGCTGGTGCAGCTGGAAACTTAGCTTGCATTTCATCTAAACTCTCCCAGGTGTCAGCAGAAGAAGACACACCGGACCAACGAATTAGAACTT
AAGTTCTAATTCGTTGGTCCGGTGTGTCTTCTTCTGCTGACACCTGGGAGAGTTTAGATGAAATGCAAGCTAAGTTTCCAGCTGCACCAGCCTGGGGACA[G/A]
GCTGAAACTCAAGGAGGGAGGAATGTTACGGCATCAATACAGAGCACTACCCATAACTCTAGTATCATTGGGCCTAGAAGATCCAAACGAGAAGTCCACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.40% | 4.70% | 0.63% | 3.26% | NA |
| All Indica | 2759 | 98.20% | 1.30% | 0.04% | 0.47% | NA |
| All Japonica | 1512 | 88.90% | 0.00% | 1.92% | 9.19% | NA |
| Aus | 269 | 45.00% | 55.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.00% | 0.34% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 0.80% | 0.00% | 0.66% | NA |
| Indica Intermediate | 786 | 95.80% | 3.40% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 95.70% | 0.00% | 0.91% | 3.39% | NA |
| Tropical Japonica | 504 | 95.00% | 0.00% | 0.60% | 4.37% | NA |
| Japonica Intermediate | 241 | 54.40% | 0.00% | 7.88% | 37.76% | NA |
| VI/Aromatic | 96 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0434853783 | C -> DEL | LOC_Os04g58610.1 | N | frameshift_variant | Average:48.563; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0434853783 | C -> T | LOC_Os04g58610.1 | synonymous_variant ; p.Gln302Gln; LOW | synonymous_codon | Average:48.563; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0434853783 | NA | 2.48E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434853783 | NA | 6.93E-08 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434853783 | NA | 6.81E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434853783 | NA | 5.91E-08 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434853783 | NA | 2.60E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434853783 | NA | 2.71E-09 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434853783 | 3.22E-06 | NA | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434853783 | NA | 1.89E-15 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434853783 | 8.55E-06 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0434853783 | 1.11E-06 | 4.09E-23 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/