RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0434849787:

Variant ID: vg0434849787 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 34849787
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTTATAGCCTTTCTTTTATATATCATTCATACCACATCATCTCTGGTTTGAAATATATATTTGTTTGACAAATAAAATTGCTCCGTAATATTTAGCACG[G/A]
ACATATTTTTTTAAAGATCACCCGCGGGGGAGTACAAGTTTAGAAGTAGAGTGGGCAGAGGGAATACAACATATTAATTACAGGGAGCTGAGGGAGTTTA

Reverse complement sequence

TAAACTCCCTCAGCTCCCTGTAATTAATATGTTGTATTCCCTCTGCCCACTCTACTTCTAAACTTGTACTCCCCCGCGGGTGATCTTTAAAAAAATATGT[C/T]
CGTGCTAAATATTACGGAGCAATTTTATTTGTCAAACAAATATATATTTCAAACCAGAGATGATGTGGTATGAATGATATATAAAAGAAAGGCTATAAGC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.30%	4.70%	0.15%	3.83%	NA
All Indica	2759	98.20%	1.30%	0.07%	0.43%	NA
All Japonica	1512	88.60%	0.00%	0.33%	11.04%	NA
Aus	269	45.40%	54.60%	0.00%	0.00%	NA
Indica I	595	99.50%	0.20%	0.00%	0.34%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	98.60%	0.80%	0.11%	0.55%	NA
Indica Intermediate	786	95.80%	3.40%	0.13%	0.64%	NA
Temperate Japonica	767	95.40%	0.00%	0.13%	4.43%	NA
Tropical Japonica	504	94.60%	0.00%	0.20%	5.16%	NA
Japonica Intermediate	241	54.40%	0.00%	1.24%	44.40%	NA
VI/Aromatic	96	67.70%	32.30%	0.00%	0.00%	NA
Intermediate	90	88.90%	8.90%	0.00%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0434849787	G -> DEL	N	N	silent_mutation	Average:34.26; most accessible tissue: Callus, score: 64.541	N	N	N	N
vg0434849787	G -> A	LOC_Os04g58610.1	downstream_gene_variant ; 3180.0bp to feature; MODIFIER	silent_mutation	Average:34.26; most accessible tissue: Callus, score: 64.541	N	N	N	N
vg0434849787	G -> A	LOC_Os04g58600-LOC_Os04g58610	intergenic_region ; MODIFIER	silent_mutation	Average:34.26; most accessible tissue: Callus, score: 64.541	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0434849787	NA	4.24E-07	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434849787	NA	9.25E-09	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434849787	NA	7.96E-07	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434849787	NA	7.29E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434849787	NA	7.97E-09	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434849787	NA	2.17E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434849787	9.95E-06	2.62E-09	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434849787	NA	1.64E-16	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434849787	NA	5.50E-17	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434849787	5.63E-06	2.73E-23	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 60 entries

Previous1 2 3 4 5 6Next

Search for Variation information by Variation ID:

Detailed information for vg0434849787:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact