Variant ID: vg0434789415 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 34789415 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 304. )
CTTCTTGCATCCAGAAGATAGCAGCCAGGAGAAAGTGAAATTATGGCTGTTGAAGGATAAATTAAGGCAAGCAGTGTCCAAACACTTGCATATACTTATA[A/T]
TGTTGCTAATTACGGTCCACTAATATGATAAATTGATGTATTTGATTTATCTTTTTCATCTGCATGGATGCATGGAATACAGTGGAATGGATCACGATAG
CTATCGTGATCCATTCCACTGTATTCCATGCATCCATGCAGATGAAAAAGATAAATCAAATACATCAATTTATCATATTAGTGGACCGTAATTAGCAACA[T/A]
TATAAGTATATGCAAGTGTTTGGACACTGCTTGCCTTAATTTATCCTTCAACAGCCATAATTTCACTTTCTCCTGGCTGCTATCTTCTGGATGCAAGAAG
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 39.40% | 60.60% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0434789415 | A -> T | LOC_Os04g58470.1 | upstream_gene_variant ; 4289.0bp to feature; MODIFIER | silent_mutation | Average:49.772; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
vg0434789415 | A -> T | LOC_Os04g58490.1 | downstream_gene_variant ; 1370.0bp to feature; MODIFIER | silent_mutation | Average:49.772; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
vg0434789415 | A -> T | LOC_Os04g58504.1 | downstream_gene_variant ; 2432.0bp to feature; MODIFIER | silent_mutation | Average:49.772; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
vg0434789415 | A -> T | LOC_Os04g58480.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.772; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0434789415 | NA | 9.37E-07 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434789415 | NA | 1.91E-07 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434789415 | NA | 8.69E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434789415 | NA | 1.82E-07 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434789415 | NA | 4.05E-09 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434789415 | 6.84E-06 | 2.46E-22 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434789415 | 1.76E-07 | 8.84E-29 | mr1098 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434789415 | 5.54E-07 | 2.83E-26 | mr1101 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434789415 | 8.89E-08 | 9.42E-20 | mr1113 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434789415 | 4.66E-07 | 2.22E-19 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/