Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0434782748:

Variant ID: vg0434782748 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 34782748
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGAATTTCCCTTGCTATATTTTGGAATTATGACATGCAAAAGTGAACCATACCTTTAATATAAAAAAACATGGTAACAGAGATTACTAGAGCATTGAA[A/G]
ACCACTACAGTTATCCATGGCGTGGCAACAACAAAATAACGAATCAGAAGCAACCAGATAACTGACAAGAAAAGAGGGAGCAGTCCACCGCAAACAATTA

Reverse complement sequence

TAATTGTTTGCGGTGGACTGCTCCCTCTTTTCTTGTCAGTTATCTGGTTGCTTCTGATTCGTTATTTTGTTGTTGCCACGCCATGGATAACTGTAGTGGT[T/C]
TTCAATGCTCTAGTAATCTCTGTTACCATGTTTTTTTATATTAAAGGTATGGTTCACTTTTGCATGTCATAATTCCAAAATATAGCAAGGGAAATTCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 31.10% 0.02% 0.00% NA
All Indica  2759 97.70% 2.30% 0.00% 0.00% NA
All Japonica  1512 13.10% 86.80% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 8.10% 91.90% 0.00% 0.00% NA
Japonica Intermediate  241 50.20% 49.40% 0.41% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0434782748 A -> G LOC_Os04g58470.1 synonymous_variant ; p.Val288Val; LOW synonymous_codon Average:45.167; most accessible tissue: Callus, score: 62.121 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0434782748 NA 2.64E-100 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 7.12E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 6.83E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 8.98E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 4.13E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 4.11E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 3.43E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 6.53E-20 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 3.34E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 3.34E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 4.47E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 2.97E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 3.88E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 3.14E-26 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 2.78E-15 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 1.18E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 3.86E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 6.30E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 7.53E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 1.19E-45 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 4.56E-07 NA mr1558_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0434782748 NA 3.43E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251