Variant ID: vg0434775690 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 34775690 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGTTGGCTCCTCGTAAGCTCCGGCTTCGTAGGCTGTGGAGGTTGTGTTGGCTTTGAGATTCGATGTCTAAACCCCCTCTCGGGGGGCCCCTTTTATATC[G/A]
CAGATGTGGAGGTCTCCTCATAGAACTCGGAGGTATCAGACCCTATACGATACGCCAACGACCCAGTTCTGCCCGAGTAGGATTCTTCCCATCTATAGAT
ATCTATAGATGGGAAGAATCCTACTCGGGCAGAACTGGGTCGTTGGCGTATCGTATAGGGTCTGATACCTCCGAGTTCTATGAGGAGACCTCCACATCTG[C/T]
GATATAAAAGGGGCCCCCCGAGAGGGGGTTTAGACATCGAATCTCAAAGCCAACACAACCTCCACAGCCTACGAAGCCGGAGCTTACGAGGAGCCAACTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 39.80% | 60.20% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0434775690 | G -> A | LOC_Os04g58450.1 | upstream_gene_variant ; 458.0bp to feature; MODIFIER | silent_mutation | Average:58.941; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
vg0434775690 | G -> A | LOC_Os04g58460.1 | downstream_gene_variant ; 998.0bp to feature; MODIFIER | silent_mutation | Average:58.941; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
vg0434775690 | G -> A | LOC_Os04g58470.1 | downstream_gene_variant ; 4807.0bp to feature; MODIFIER | silent_mutation | Average:58.941; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
vg0434775690 | G -> A | LOC_Os04g58450-LOC_Os04g58460 | intergenic_region ; MODIFIER | silent_mutation | Average:58.941; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0434775690 | NA | 8.22E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434775690 | NA | 4.97E-07 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434775690 | NA | 4.65E-07 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434775690 | NA | 3.64E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434775690 | NA | 2.97E-15 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434775690 | NA | 4.20E-10 | mr1126 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434775690 | NA | 4.10E-16 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434775690 | NA | 7.17E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434775690 | 3.74E-07 | 4.01E-20 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0434775690 | NA | 1.58E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/