Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433353615:

Variant ID: vg0433353615 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33353615
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCTAATTATAGACAAATTAGGCTGAAAAGATTCGTCTCGCGATTTCTATGTAAATTGTACAAGTGGTTTTTATTTTTATCTATATTTAATGCTCTATG[C/T]
ATGTGTTTAAAGATTAGATGTGATGTTTTTAGGAAAAAAAATTAGTAACTAAACCAGCCAAGTGCTCGATCGCCGTTTAATTCTGACCGCTTGCTTGTAC

Reverse complement sequence

GTACAAGCAAGCGGTCAGAATTAAACGGCGATCGAGCACTTGGCTGGTTTAGTTACTAATTTTTTTTCCTAAAAACATCACATCTAATCTTTAAACACAT[G/A]
CATAGAGCATTAAATATAGATAAAAATAAAAACCACTTGTACAATTTACATAGAAATCGCGAGACGAATCTTTTCAGCCTAATTTGTCTATAATTAGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.80% 0.06% 0.00% NA
All Indica  2759 92.20% 7.80% 0.07% 0.00% NA
All Japonica  1512 3.20% 96.80% 0.00% 0.00% NA
Aus  269 32.70% 67.30% 0.00% 0.00% NA
Indica I  595 94.60% 5.20% 0.17% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 86.70% 13.30% 0.00% 0.00% NA
Indica Intermediate  786 93.60% 6.20% 0.13% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433353615 C -> T LOC_Os04g56000.1 upstream_gene_variant ; 1155.0bp to feature; MODIFIER silent_mutation Average:67.061; most accessible tissue: Minghui63 root, score: 88.381 N N N N
vg0433353615 C -> T LOC_Os04g56000-LOC_Os04g56010 intergenic_region ; MODIFIER silent_mutation Average:67.061; most accessible tissue: Minghui63 root, score: 88.381 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433353615 C T 0.0 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433353615 NA 2.92E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 7.04E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 1.72E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 9.81E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 6.89E-14 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 1.58E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 9.95E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 8.84E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 3.08E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 5.53E-25 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 2.01E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 1.30E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 1.45E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 5.92E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 1.52E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 6.78E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 3.83E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 5.23E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 4.53E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 2.35E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 2.79E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 2.10E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 1.11E-10 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 4.75E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 5.49E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 2.93E-24 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 5.73E-10 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 2.65E-06 NA mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 1.56E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 4.62E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 2.39E-23 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 9.02E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 1.08E-24 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 2.62E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433353615 NA 2.32E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251