| Variant ID: vg0433192266 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 33192266 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 105. )
GTCATTGAGTTGGGAATGGCGTAATGACGGATTATTATTTTTTAGATAATGAAATATAATATCCCGGCCTTTGCTCAAAAAGAACTACAGCCAATTATTA[T/C,A]
AAAGATCCACTCCAGAAGAGAGTGTAGTTCAAGACAAGTTGAACACACCAAACAAGAGAAGAAATGACCCAAACTGAGAAAAGCAAAACAAAATGTGGAG
CTCCACATTTTGTTTTGCTTTTCTCAGTTTGGGTCATTTCTTCTCTTGTTTGGTGTGTTCAACTTGTCTTGAACTACACTCTCTTCTGGAGTGGATCTTT[A/G,T]
TAATAATTGGCTGTAGTTCTTTTTGAGCAAAGGCCGGGATATTATATTTCATTATCTAAAAAATAATAATCCGTCATTACGCCATTCCCAACTCAATGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.90% | 45.40% | 0.23% | 0.44% | A: 0.02% |
| All Indica | 2759 | 82.50% | 17.00% | 0.40% | 0.07% | A: 0.04% |
| All Japonica | 1512 | 4.30% | 94.40% | 0.00% | 1.26% | NA |
| Aus | 269 | 33.80% | 66.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.30% | 7.10% | 0.50% | 0.17% | NA |
| Indica II | 465 | 94.80% | 4.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 70.40% | 29.10% | 0.33% | 0.00% | A: 0.11% |
| Indica Intermediate | 786 | 81.90% | 17.60% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 1.30% | 96.20% | 0.00% | 2.48% | NA |
| Tropical Japonica | 504 | 6.50% | 93.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 9.10% | 90.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0433192266 | T -> C | LOC_Os04g55760.1 | upstream_gene_variant ; 357.0bp to feature; MODIFIER | silent_mutation | Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0433192266 | T -> C | LOC_Os04g55770.1 | downstream_gene_variant ; 4252.0bp to feature; MODIFIER | silent_mutation | Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0433192266 | T -> C | LOC_Os04g55750-LOC_Os04g55760 | intergenic_region ; MODIFIER | silent_mutation | Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0433192266 | T -> DEL | N | N | silent_mutation | Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0433192266 | T -> A | LOC_Os04g55760.1 | upstream_gene_variant ; 357.0bp to feature; MODIFIER | silent_mutation | Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0433192266 | T -> A | LOC_Os04g55770.1 | downstream_gene_variant ; 4252.0bp to feature; MODIFIER | silent_mutation | Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0433192266 | T -> A | LOC_Os04g55750-LOC_Os04g55760 | intergenic_region ; MODIFIER | silent_mutation | Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0433192266 | 4.49E-06 | 4.49E-06 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433192266 | 5.26E-07 | 2.06E-07 | mr1022 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433192266 | 7.69E-06 | NA | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433192266 | 1.79E-06 | 1.79E-06 | mr1067 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433192266 | 5.21E-06 | NA | mr1079 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433192266 | 3.91E-07 | NA | mr1132 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433192266 | 9.63E-07 | NA | mr1142 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433192266 | 6.93E-06 | NA | mr1489 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433192266 | 4.42E-07 | 4.42E-07 | mr1542 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0433192266 | NA | 5.85E-10 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/