Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433122732:

Variant ID: vg0433122732 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33122732
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, T: 0.13, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTCATCAAACACAAACTACTAATAACATTTTTCATGCAATCAACCAATTTTTATAGCTATCGATAATTATCGATATGGAGACAGTAACGGTGTCAAAC[A/T]
CAAACGACAAATAACGTTTTTATGTAATCAACTAATTTTTATAGGTGTTGATAGTTATTATCGGCAGTGAAGAAGGTAACGGTGGACGTGGTGAGTGGTG

Reverse complement sequence

CACCACTCACCACGTCCACCGTTACCTTCTTCACTGCCGATAATAACTATCAACACCTATAAAAATTAGTTGATTACATAAAAACGTTATTTGTCGTTTG[T/A]
GTTTGACACCGTTACTGTCTCCATATCGATAATTATCGATAGCTATAAAAATTGGTTGATTGCATGAAAAATGTTATTAGTAGTTTGTGTTTGATGACAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 17.70% 0.51% 0.00% NA
All Indica  2759 75.20% 24.00% 0.80% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 74.30% 24.90% 0.74% 0.00% NA
Indica I  595 88.20% 9.90% 1.85% 0.00% NA
Indica II  465 55.30% 43.90% 0.86% 0.00% NA
Indica III  913 79.10% 20.80% 0.11% 0.00% NA
Indica Intermediate  786 72.50% 26.70% 0.76% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433122732 A -> T LOC_Os04g55640.1 downstream_gene_variant ; 3028.0bp to feature; MODIFIER silent_mutation Average:99.053; most accessible tissue: Minghui63 root, score: 99.814 N N N N
vg0433122732 A -> T LOC_Os04g55650.1 downstream_gene_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:99.053; most accessible tissue: Minghui63 root, score: 99.814 N N N N
vg0433122732 A -> T LOC_Os04g55650.2 downstream_gene_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:99.053; most accessible tissue: Minghui63 root, score: 99.814 N N N N
vg0433122732 A -> T LOC_Os04g55640-LOC_Os04g55650 intergenic_region ; MODIFIER silent_mutation Average:99.053; most accessible tissue: Minghui63 root, score: 99.814 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433122732 A T 0.02 0.03 0.02 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433122732 NA 6.73E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433122732 4.86E-06 1.35E-07 mr1834_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251