Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432784993:

Variant ID: vg0432784993 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32784993
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATCGAGTTCTTGTTGTGCAAGAACGGCTCGCATCTTAACTTGCCAAAGTGAGAATCTTGTGTCTCGGTCCAGGAGCGGTAGATCATACTTCAAACTCG[T/C]
CATGGGAATTAATCCTGAAATTTGCTAGTAAGAAATTAGGGTAAACTAGCAAAAACGCGAAACCTGGTACACTTCTCGTGTGCATGTAGTGTAGATCTGA

Reverse complement sequence

TCAGATCTACACTACATGCACACGAGAAGTGTACCAGGTTTCGCGTTTTTGCTAGTTTACCCTAATTTCTTACTAGCAAATTTCAGGATTAATTCCCATG[A/G]
CGAGTTTGAAGTATGATCTACCGCTCCTGGACCGAGACACAAGATTCTCACTTTGGCAAGTTAAGATGCGAGCCGTTCTTGCACAACAAGAACTCGATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.80% 12.00% 2.67% 60.52% NA
All Indica  2759 4.20% 2.90% 3.30% 89.60% NA
All Japonica  1512 61.10% 29.50% 1.19% 8.20% NA
Aus  269 34.90% 4.10% 4.09% 56.88% NA
Indica I  595 4.20% 3.00% 2.52% 90.25% NA
Indica II  465 1.70% 0.60% 2.37% 95.27% NA
Indica III  913 5.40% 3.60% 3.29% 87.73% NA
Indica Intermediate  786 4.30% 3.30% 4.45% 87.91% NA
Temperate Japonica  767 86.80% 12.30% 0.00% 0.91% NA
Tropical Japonica  504 32.50% 42.70% 3.57% 21.23% NA
Japonica Intermediate  241 39.00% 56.80% 0.00% 4.15% NA
VI/Aromatic  96 9.40% 21.90% 1.04% 67.71% NA
Intermediate  90 32.20% 11.10% 5.56% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432784993 T -> C LOC_Os04g55140.1 missense_variant ; p.Thr2Ala; MODERATE nonsynonymous_codon ; T2A Average:18.57; most accessible tissue: Callus, score: 88.441 unknown unknown TOLERATED 1.00
vg0432784993 T -> DEL LOC_Os04g55140.1 N frameshift_variant Average:18.57; most accessible tissue: Callus, score: 88.441 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432784993 NA 5.11E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 2.67E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 8.90E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 5.37E-09 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 5.12E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 1.22E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 1.17E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 5.37E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 4.79E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 6.89E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 2.66E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 2.97E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 5.76E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 7.15E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 4.53E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 1.03E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 1.69E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432784993 NA 1.52E-11 mr1805_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251