Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432524793:

Variant ID: vg0432524793 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32524793
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.31, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGGACCGACTTCGGCCTCGGCCTCGAGCTCGGGCTCGGGACCGCCCTCGGCCTCGGCCCCAACCTCGGGCTCGAGGCCACCTCCGGCTCCGGCTCTCG[A/G]
GCCGCGTCTTCCTTCACCCCCTGATCCTGGGTAGTGCTCCGCGTGGGCCCTGGTCCCAGAGCCGCCCTCGGGAGGAGCGTCACCGCTCCTCACGCCGGCG

Reverse complement sequence

CGCCGGCGTGAGGAGCGGTGACGCTCCTCCCGAGGGCGGCTCTGGGACCAGGGCCCACGCGGAGCACTACCCAGGATCAGGGGGTGAAGGAAGACGCGGC[T/C]
CGAGAGCCGGAGCCGGAGGTGGCCTCGAGCCCGAGGTTGGGGCCGAGGCCGAGGGCGGTCCCGAGCCCGAGCTCGAGGCCGAGGCCGAAGTCGGTCCCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.90% 28.20% 0.89% 0.00% NA
All Indica  2759 73.70% 26.00% 0.29% 0.00% NA
All Japonica  1512 75.50% 22.80% 1.79% 0.00% NA
Aus  269 15.60% 84.00% 0.37% 0.00% NA
Indica I  595 91.90% 8.10% 0.00% 0.00% NA
Indica II  465 74.40% 25.40% 0.22% 0.00% NA
Indica III  913 57.60% 42.10% 0.33% 0.00% NA
Indica Intermediate  786 78.10% 21.40% 0.51% 0.00% NA
Temperate Japonica  767 77.40% 21.90% 0.65% 0.00% NA
Tropical Japonica  504 73.40% 25.60% 0.99% 0.00% NA
Japonica Intermediate  241 73.40% 19.50% 7.05% 0.00% NA
VI/Aromatic  96 75.00% 22.90% 2.08% 0.00% NA
Intermediate  90 72.20% 23.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432524793 A -> G LOC_Os04g54670.1 missense_variant ; p.Ser1202Pro; MODERATE nonsynonymous_codon ; S1202P Average:74.29; most accessible tissue: Minghui63 young leaf, score: 85.437 unknown unknown TOLERATED 0.25

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432524793 A G 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432524793 4.26E-06 4.26E-06 mr1784 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 NA 7.74E-06 mr1785 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 1.53E-07 2.06E-10 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 2.77E-07 6.62E-09 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 NA 5.01E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 NA 3.89E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 NA 1.67E-08 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 5.86E-08 3.37E-11 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 2.02E-06 NA mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 5.37E-06 NA mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 6.33E-07 NA mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 4.72E-07 1.13E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 1.10E-13 5.36E-18 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 2.43E-09 8.32E-11 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 2.51E-06 NA mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432524793 4.26E-06 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251