Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432467580:

Variant ID: vg0432467580 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32467580
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.43, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

GCCGTCATCGCCATCGTCACCGCCTCGGCCCCGCCACTCCCGCGCTAGCCTCCAAGGGACGGAGGCAGAGCCTCCCTCCTCCCTCTGCCGCGACGCCTCC[A/G]
CTCCCTCCTCCTTTTCCCGAAGAGGCAAGGGGACAAGCCCCTTTCCCCCCCTCCTTTTTCCCCTTTTTCCTTCCGCCGGCGTCATCCTCCCTCCCTCCTG

Reverse complement sequence

CAGGAGGGAGGGAGGATGACGCCGGCGGAAGGAAAAAGGGGAAAAAGGAGGGGGGGAAAGGGGCTTGTCCCCTTGCCTCTTCGGGAAAAGGAGGAGGGAG[T/C]
GGAGGCGTCGCGGCAGAGGGAGGAGGGAGGCTCTGCCTCCGTCCCTTGGAGGCTAGCGCGGGAGTGGCGGGGCCGAGGCGGTGACGATGGCGATGACGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.60%	27.30%	6.88%	8.25%	NA
All Indica	2759	81.80%	4.10%	7.97%	6.13%	NA
All Japonica	1512	25.70%	67.10%	1.46%	5.75%	NA
Aus	269	7.10%	42.00%	21.56%	29.37%	NA
Indica I	595	84.90%	9.20%	1.18%	4.71%	NA
Indica II	465	82.40%	3.00%	9.25%	5.38%	NA
Indica III	913	79.60%	1.10%	13.25%	6.02%	NA
Indica Intermediate	786	81.70%	4.30%	6.23%	7.76%	NA
Temperate Japonica	767	3.30%	96.10%	0.39%	0.26%	NA
Tropical Japonica	504	67.10%	16.70%	0.99%	15.28%	NA
Japonica Intermediate	241	10.40%	80.50%	5.81%	3.32%	NA
VI/Aromatic	96	9.40%	20.80%	22.92%	46.88%	NA
Intermediate	90	53.30%	32.20%	3.33%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432467580	A -> DEL	N	N	silent_mutation	Average:35.552; most accessible tissue: Zhenshan97 flower, score: 77.563	N	N	N	N
vg0432467580	A -> G	LOC_Os04g54600.1	downstream_gene_variant ; 1506.0bp to feature; MODIFIER	silent_mutation	Average:35.552; most accessible tissue: Zhenshan97 flower, score: 77.563	N	N	N	N
vg0432467580	A -> G	LOC_Os04g54600-LOC_Os04g54610	intergenic_region ; MODIFIER	silent_mutation	Average:35.552; most accessible tissue: Zhenshan97 flower, score: 77.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432467580	NA	3.75E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580	NA	2.43E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580	NA	1.36E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580	NA	3.41E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580	NA	5.73E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580	NA	6.10E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580	NA	9.16E-08	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580	4.99E-06	3.36E-10	mr1741_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432467580	NA	2.29E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251