Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432426919:

Variant ID: vg0432426919 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32426919
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CAGACCGTCGCGACGAGGGCGACGAAGCTGGACGGTGGCCGACGCGGTGGTGCGCCGTGGGCTTCGCCGTCTCGGACGATGCGTTCACTGGTGAAAAAAT[A/G,T]
TTTTTTACTCCCGGTTTAGAACCTCACTACGAATCCGGGACTAAAAATCGATAAGATGGAGGAGTAAAGAGAGGGAATCTTTAGTCCCGGTTGGTGGGAA

Reverse complement sequence

TTCCCACCAACCGGGACTAAAGATTCCCTCTCTTTACTCCTCCATCTTATCGATTTTTAGTCCCGGATTCGTAGTGAGGTTCTAAACCGGGAGTAAAAAA[T/C,A]
ATTTTTTCACCAGTGAACGCATCGTCCGAGACGGCGAAGCCCACGGCGCACCACCGCGTCGGCCACCGTCCAGCTTCGTCGCCCTCGTCGCGACGGTCTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	24.70%	0.04%	0.00%	T: 0.04%
All Indica	2759	71.80%	28.20%	0.04%	0.00%	NA
All Japonica	1512	93.20%	6.70%	0.07%	0.00%	NA
Aus	269	24.20%	75.10%	0.00%	0.00%	T: 0.74%
Indica I	595	92.10%	7.70%	0.17%	0.00%	NA
Indica II	465	75.50%	24.50%	0.00%	0.00%	NA
Indica III	913	51.20%	48.80%	0.00%	0.00%	NA
Indica Intermediate	786	78.10%	21.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	81.50%	18.50%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432426919	A -> G	LOC_Os04g54510.1	upstream_gene_variant ; 1301.0bp to feature; MODIFIER	silent_mutation	Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0432426919	A -> G	LOC_Os04g54500.1	downstream_gene_variant ; 2922.0bp to feature; MODIFIER	silent_mutation	Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0432426919	A -> G	LOC_Os04g54520.1	downstream_gene_variant ; 3110.0bp to feature; MODIFIER	silent_mutation	Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0432426919	A -> G	LOC_Os04g54510-LOC_Os04g54520	intergenic_region ; MODIFIER	silent_mutation	Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0432426919	A -> T	LOC_Os04g54510.1	upstream_gene_variant ; 1301.0bp to feature; MODIFIER	silent_mutation	Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0432426919	A -> T	LOC_Os04g54500.1	downstream_gene_variant ; 2922.0bp to feature; MODIFIER	silent_mutation	Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0432426919	A -> T	LOC_Os04g54520.1	downstream_gene_variant ; 3110.0bp to feature; MODIFIER	silent_mutation	Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0432426919	A -> T	LOC_Os04g54510-LOC_Os04g54520	intergenic_region ; MODIFIER	silent_mutation	Average:76.891; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432426919	NA	4.92E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	NA	7.75E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	5.98E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	NA	5.34E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	NA	2.60E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	3.58E-06	2.66E-10	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	NA	5.17E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	1.69E-11	4.56E-16	mr1800	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	1.12E-09	2.15E-11	mr1800	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	1.17E-06	NA	mr1862	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	NA	9.80E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	NA	3.74E-06	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	NA	2.39E-06	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	NA	6.54E-08	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	2.09E-08	1.46E-15	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	8.71E-06	NA	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	NA	1.01E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	2.78E-16	7.51E-28	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	2.28E-11	2.93E-13	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	5.59E-07	6.71E-12	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432426919	3.32E-06	NA	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251