Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432212227:

Variant ID: vg0432212227 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32212227
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.39, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ACGGCCGGGGGCTAGGATCAGTGCTTATTCAACCAAGGCAGGTCAAGAGTCCAAGAGCCTACTCCTCTGAGAACGATTCTCCGACGACAAGGCTGGGGGC[T/C]
AGGGAGAGTGAACAACTCAAACGACTGACCAAAGTCGTGAACTGAGAAGACACTCTTACACAAAACATTGGTCGGTAAATTTAATTCATTTTCAATTTAC

Reverse complement sequence

GTAAATTGAAAATGAATTAAATTTACCGACCAATGTTTTGTGTAAGAGTGTCTTCTCAGTTCACGACTTTGGTCAGTCGTTTGAGTTGTTCACTCTCCCT[A/G]
GCCCCCAGCCTTGTCGTCGGAGAATCGTTCTCAGAGGAGTAGGCTCTTGGACTCTTGACCTGCCTTGGTTGAATAAGCACTGATCCTAGCCCCCGGCCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	31.40%	2.52%	2.52%	NA
All Indica	2759	89.20%	5.70%	2.46%	2.65%	NA
All Japonica	1512	31.00%	67.30%	1.65%	0.00%	NA
Aus	269	7.40%	74.70%	5.95%	11.90%	NA
Indica I	595	89.70%	9.90%	0.17%	0.17%	NA
Indica II	465	88.80%	3.20%	2.15%	5.81%	NA
Indica III	913	91.60%	3.10%	2.96%	2.41%	NA
Indica Intermediate	786	86.10%	7.10%	3.82%	2.93%	NA
Temperate Japonica	767	6.10%	93.20%	0.65%	0.00%	NA
Tropical Japonica	504	59.90%	38.90%	1.19%	0.00%	NA
Japonica Intermediate	241	49.80%	44.40%	5.81%	0.00%	NA
VI/Aromatic	96	12.50%	71.90%	7.29%	8.33%	NA
Intermediate	90	48.90%	41.10%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432212227	T -> C	LOC_Os04g54040.1	upstream_gene_variant ; 4617.0bp to feature; MODIFIER	silent_mutation	Average:22.15; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0432212227	T -> C	LOC_Os04g54060.1	upstream_gene_variant ; 2607.0bp to feature; MODIFIER	silent_mutation	Average:22.15; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0432212227	T -> C	LOC_Os04g54050.1	intron_variant ; MODIFIER	silent_mutation	Average:22.15; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0432212227	T -> DEL	N	N	silent_mutation	Average:22.15; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432212227	NA	2.92E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212227	5.08E-06	3.75E-08	mr1177	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212227	NA	3.82E-07	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212227	NA	8.41E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212227	NA	1.21E-12	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432212227	NA	1.69E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251