Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432204214:

Variant ID: vg0432204214 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 32204214
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.18, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTAGGTTGGACTTTGGAGGGAGCGGGCAGAGCAGGCGAAAGCCAAACCTCGCGTCTGTCCCATGGCGTGGCGGGTTCTCCTACCAGCGTTGGGTAGTA[C/T]
TTCCTCCGTATTAGGTTACACAAGTCGTTTAAATTTGTTGTCAAAATTAAACTATTTCAAATTTAATTAAGCTCATAGAAAAAAATAGAAACATTTTCAA

Reverse complement sequence

TTGAAAATGTTTCTATTTTTTTCTATGAGCTTAATTAAATTTGAAATAGTTTAATTTTGACAACAAATTTAAACGACTTGTGTAACCTAATACGGAGGAA[G/A]
TACTACCCAACGCTGGTAGGAGAACCCGCCACGCCATGGGACAGACGCGAGGTTTGGCTTTCGCCTGCTCTGCCCGCTCCCTCCAAAGTCCAACCTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.40%	17.90%	14.60%	36.10%	NA
All Indica	2759	6.10%	22.80%	19.21%	51.90%	NA
All Japonica	1512	66.50%	8.90%	9.39%	15.28%	NA
Aus	269	77.00%	17.50%	2.23%	3.35%	NA
Indica I	595	9.60%	12.30%	21.51%	56.64%	NA
Indica II	465	3.70%	22.80%	15.70%	57.85%	NA
Indica III	913	3.50%	29.40%	18.40%	48.74%	NA
Indica Intermediate	786	7.80%	23.30%	20.48%	48.47%	NA
Temperate Japonica	767	92.70%	1.40%	1.96%	3.91%	NA
Tropical Japonica	504	37.50%	20.20%	18.45%	23.81%	NA
Japonica Intermediate	241	43.60%	8.70%	14.11%	33.61%	NA
VI/Aromatic	96	72.90%	18.80%	3.12%	5.21%	NA
Intermediate	90	41.10%	16.70%	10.00%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0432204214	C -> DEL	N	N	silent_mutation	Average:48.981; most accessible tissue: Callus, score: 87.454	N	N	N	N
vg0432204214	C -> T	LOC_Os04g54020.1	upstream_gene_variant ; 1493.0bp to feature; MODIFIER	silent_mutation	Average:48.981; most accessible tissue: Callus, score: 87.454	N	N	N	N
vg0432204214	C -> T	LOC_Os04g54030.1	upstream_gene_variant ; 1305.0bp to feature; MODIFIER	silent_mutation	Average:48.981; most accessible tissue: Callus, score: 87.454	N	N	N	N
vg0432204214	C -> T	LOC_Os04g54050.1	upstream_gene_variant ; 4691.0bp to feature; MODIFIER	silent_mutation	Average:48.981; most accessible tissue: Callus, score: 87.454	N	N	N	N
vg0432204214	C -> T	LOC_Os04g54040.1	downstream_gene_variant ; 2447.0bp to feature; MODIFIER	silent_mutation	Average:48.981; most accessible tissue: Callus, score: 87.454	N	N	N	N
vg0432204214	C -> T	LOC_Os04g54020-LOC_Os04g54030	intergenic_region ; MODIFIER	silent_mutation	Average:48.981; most accessible tissue: Callus, score: 87.454	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0432204214	3.12E-06	7.53E-06	mr1128	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214	NA	1.61E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214	NA	2.51E-07	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214	NA	8.69E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214	NA	4.48E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214	NA	3.42E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214	NA	3.65E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432204214	NA	3.42E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251