Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431915576:

Variant ID: vg0431915576 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31915576
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCATCTTACGTAGGAGTAGTAGCCAAAATTAAACATGTGCGTAAAAAAAAACTTCAACTTTTGTACAGAGGCTGCGTTTAGATCTAAAGTTTGTTTGG[A/T]
TCCAAACTTCAGTCCTTTTCCATCACATCAATATGTCATACACACGTAACTTTTCAGTCACATCATCTCCAATTTCAACCAAAATACAAACTTTGCGCTG

Reverse complement sequence

CAGCGCAAAGTTTGTATTTTGGTTGAAATTGGAGATGATGTGACTGAAAAGTTACGTGTGTATGACATATTGATGTGATGGAAAAGGACTGAAGTTTGGA[T/A]
CCAAACAAACTTTAGATCTAAACGCAGCCTCTGTACAAAAGTTGAAGTTTTTTTTTACGCACATGTTTAATTTTGGCTACTACTCCTACGTAAGATGGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 24.60% 0.23% 2.81% NA
All Indica  2759 82.80% 16.60% 0.18% 0.40% NA
All Japonica  1512 58.60% 33.10% 0.33% 7.94% NA
Aus  269 43.90% 55.80% 0.37% 0.00% NA
Indica I  595 94.30% 5.40% 0.17% 0.17% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 67.10% 31.80% 0.33% 0.77% NA
Indica Intermediate  786 84.60% 14.90% 0.13% 0.38% NA
Temperate Japonica  767 90.20% 9.60% 0.13% 0.00% NA
Tropical Japonica  504 18.50% 57.70% 0.79% 23.02% NA
Japonica Intermediate  241 41.90% 56.40% 0.00% 1.66% NA
VI/Aromatic  96 57.30% 41.70% 0.00% 1.04% NA
Intermediate  90 82.20% 16.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431915576 A -> DEL N N silent_mutation Average:66.678; most accessible tissue: Minghui63 root, score: 86.961 N N N N
vg0431915576 A -> T LOC_Os04g53544-LOC_Os04g53550 intergenic_region ; MODIFIER silent_mutation Average:66.678; most accessible tissue: Minghui63 root, score: 86.961 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431915576 A T -0.05 -0.04 -0.02 -0.04 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431915576 NA 1.96E-19 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431915576 NA 2.88E-09 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 2.12E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 1.90E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 1.63E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 4.72E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 2.61E-06 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 1.13E-06 NA mr1985 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 8.24E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 5.90E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 4.00E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 5.43E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 1.87E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 8.85E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 8.54E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 2.23E-07 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 8.28E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431915576 NA 7.15E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251