Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431719457:

Variant ID: vg0431719457 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31719457
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

AATGTATAAGGTCGTTATGAAATTTACATCGAGTACAAGCAGTAATATACGAGTTGTTTTTCCTTTATATTAGCTACTCCCTCTGTGTCAGGTTATAAAA[T/C]
ATTTTGACTTTAGTCAATATTAAACTGTTTCAAGTTTGACTAAGGTTGTGTTTGGATGGGAACTAATCCTTTCCGCACGAAAAACGAAACGATCTATTAG

Reverse complement sequence

CTAATAGATCGTTTCGTTTTTCGTGCGGAAAGGATTAGTTCCCATCCAAACACAACCTTAGTCAAACTTGAAACAGTTTAATATTGACTAAAGTCAAAAT[A/G]
TTTTATAACCTGACACAGAGGGAGTAGCTAATATAAAGGAAAAACAACTCGTATATTACTGCTTGTACTCGATGTAAATTTCATAACGACCTTATACATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.10%	44.70%	0.15%	0.00%	NA
All Indica	2759	71.10%	28.70%	0.14%	0.00%	NA
All Japonica	1512	26.50%	73.30%	0.13%	0.00%	NA
Aus	269	61.00%	39.00%	0.00%	0.00%	NA
Indica I	595	44.50%	55.50%	0.00%	0.00%	NA
Indica II	465	86.90%	12.90%	0.22%	0.00%	NA
Indica III	913	75.80%	24.20%	0.00%	0.00%	NA
Indica Intermediate	786	76.60%	23.00%	0.38%	0.00%	NA
Temperate Japonica	767	6.40%	93.40%	0.26%	0.00%	NA
Tropical Japonica	504	58.10%	41.90%	0.00%	0.00%	NA
Japonica Intermediate	241	24.50%	75.50%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	68.80%	0.00%	0.00%	NA
Intermediate	90	52.20%	46.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431719457	T -> C	LOC_Os04g53240.1	upstream_gene_variant ; 284.0bp to feature; MODIFIER	silent_mutation	Average:72.5; most accessible tissue: Callus, score: 91.638	N	N	N	N
vg0431719457	T -> C	LOC_Os04g53250.1	upstream_gene_variant ; 2261.0bp to feature; MODIFIER	silent_mutation	Average:72.5; most accessible tissue: Callus, score: 91.638	N	N	N	N
vg0431719457	T -> C	LOC_Os04g53240.2	upstream_gene_variant ; 284.0bp to feature; MODIFIER	silent_mutation	Average:72.5; most accessible tissue: Callus, score: 91.638	N	N	N	N
vg0431719457	T -> C	LOC_Os04g53240.3	upstream_gene_variant ; 284.0bp to feature; MODIFIER	silent_mutation	Average:72.5; most accessible tissue: Callus, score: 91.638	N	N	N	N
vg0431719457	T -> C	LOC_Os04g53240.4	upstream_gene_variant ; 284.0bp to feature; MODIFIER	silent_mutation	Average:72.5; most accessible tissue: Callus, score: 91.638	N	N	N	N
vg0431719457	T -> C	LOC_Os04g53240-LOC_Os04g53250	intergenic_region ; MODIFIER	silent_mutation	Average:72.5; most accessible tissue: Callus, score: 91.638	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431719457	NA	9.63E-06	mr1057	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431719457	1.29E-07	1.29E-07	mr1736	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431719457	NA	1.20E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431719457	NA	3.04E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431719457	NA	4.85E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251