Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431647376:

Variant ID: vg0431647376 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31647376
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TATTAGAAGTAGAGTATAGAGTCCATATAGGAATTTAAAACTAACTAAAATTCGGAAAAAAAAAAGAAGCCACCACGTTCGCTCTCATGACCTAGAAATT[C/A]
TCACATTAATCGGAGAAAAAGAAAAGGCAGAGTCTATATAGAAATACAATTCAGAAATAGCTGAAATTCAGAATTAAAAAAATAAGGAATATTAAAAGAG

Reverse complement sequence

CTCTTTTAATATTCCTTATTTTTTTAATTCTGAATTTCAGCTATTTCTGAATTGTATTTCTATATAGACTCTGCCTTTTCTTTTTCTCCGATTAATGTGA[G/T]
AATTTCTAGGTCATGAGAGCGAACGTGGTGGCTTCTTTTTTTTTTCCGAATTTTAGTTAGTTTTAAATTCCTATATGGACTCTATACTCTACTTCTAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.90%	5.60%	1.82%	27.74%	NA
All Indica	2759	56.70%	9.40%	2.57%	31.35%	NA
All Japonica	1512	76.70%	0.00%	0.53%	22.75%	NA
Aus	269	71.40%	0.40%	2.23%	26.02%	NA
Indica I	595	71.80%	4.20%	1.85%	22.18%	NA
Indica II	465	51.80%	29.70%	1.72%	16.77%	NA
Indica III	913	53.50%	0.10%	3.72%	42.72%	NA
Indica Intermediate	786	52.00%	12.00%	2.29%	33.72%	NA
Temperate Japonica	767	96.50%	0.00%	0.13%	3.39%	NA
Tropical Japonica	504	43.70%	0.00%	1.39%	54.96%	NA
Japonica Intermediate	241	83.00%	0.00%	0.00%	17.01%	NA
VI/Aromatic	96	80.20%	0.00%	0.00%	19.79%	NA
Intermediate	90	78.90%	5.60%	1.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431647376	C -> DEL	N	N	silent_mutation	Average:32.35; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0431647376	C -> A	LOC_Os04g53140.1	upstream_gene_variant ; 3145.0bp to feature; MODIFIER	silent_mutation	Average:32.35; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0431647376	C -> A	LOC_Os04g53120.1	downstream_gene_variant ; 2581.0bp to feature; MODIFIER	silent_mutation	Average:32.35; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0431647376	C -> A	LOC_Os04g53130.1	intron_variant ; MODIFIER	silent_mutation	Average:32.35; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431647376	NA	8.42E-08	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647376	NA	1.48E-06	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647376	NA	1.07E-07	mr1726	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647376	NA	1.47E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647376	NA	1.67E-06	mr1989	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431647376	NA	3.50E-06	mr1952_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251