Variant ID: vg0431530955 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 31530955 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )
AGACAAAATAACCAATGATCATGGCTATCGTCGTGCTCCTACTCCTTCCATCTCATTTTAGGTGGAAATGTGGGTCTCCGTGTCTAATGTTTAACTGTCC[G/A]
CCTTATTTGAAAATTTTATTAAAAATTAAAAAATAAGTCATGCATAAAAAAATATTTATGTTTTAATTTTAATAATAATAAAATACTAGCTATAAAAAAT
ATTTTTTATAGCTAGTATTTTATTATTATTAAAATTAAAACATAAATATTTTTTTATGCATGACTTATTTTTTAATTTTTAATAAAATTTTCAAATAAGG[C/T]
GGACAGTTAAACATTAGACACGGAGACCCACATTTCCACCTAAAATGAGATGGAAGGAGTAGGAGCACGACGATAGCCATGATCATTGGTTATTTTGTCT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 90.30% | 9.30% | 0.04% | 0.36% | NA |
All Indica | 2759 | 95.00% | 4.70% | 0.04% | 0.22% | NA |
All Japonica | 1512 | 79.20% | 20.00% | 0.07% | 0.73% | NA |
Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 95.30% | 4.20% | 0.17% | 0.34% | NA |
Indica II | 465 | 91.80% | 8.00% | 0.00% | 0.22% | NA |
Indica III | 913 | 99.10% | 0.50% | 0.00% | 0.33% | NA |
Indica Intermediate | 786 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 94.80% | 3.80% | 0.00% | 1.43% | NA |
Tropical Japonica | 504 | 49.40% | 50.40% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0431530955 | G -> DEL | N | N | silent_mutation | Average:77.575; most accessible tissue: Callus, score: 84.867 | N | N | N | N |
vg0431530955 | G -> A | LOC_Os04g52930.1 | upstream_gene_variant ; 1461.0bp to feature; MODIFIER | silent_mutation | Average:77.575; most accessible tissue: Callus, score: 84.867 | N | N | N | N |
vg0431530955 | G -> A | LOC_Os04g52940.1 | upstream_gene_variant ; 950.0bp to feature; MODIFIER | silent_mutation | Average:77.575; most accessible tissue: Callus, score: 84.867 | N | N | N | N |
vg0431530955 | G -> A | LOC_Os04g52920.1 | downstream_gene_variant ; 3094.0bp to feature; MODIFIER | silent_mutation | Average:77.575; most accessible tissue: Callus, score: 84.867 | N | N | N | N |
vg0431530955 | G -> A | LOC_Os04g52920.2 | downstream_gene_variant ; 3094.0bp to feature; MODIFIER | silent_mutation | Average:77.575; most accessible tissue: Callus, score: 84.867 | N | N | N | N |
vg0431530955 | G -> A | LOC_Os04g52930-LOC_Os04g52940 | intergenic_region ; MODIFIER | silent_mutation | Average:77.575; most accessible tissue: Callus, score: 84.867 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0431530955 | NA | 9.86E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0431530955 | NA | 5.10E-06 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0431530955 | NA | 7.09E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0431530955 | NA | 2.05E-10 | mr1328 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0431530955 | NA | 5.68E-08 | mr1328 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0431530955 | 1.21E-06 | 1.21E-06 | mr1398 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0431530955 | NA | 3.55E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0431530955 | NA | 4.79E-07 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0431530955 | NA | 7.71E-09 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0431530955 | NA | 2.87E-06 | mr1989 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/