Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431489327:

Variant ID: vg0431489327 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31489327
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCCCAGGTGAGTTATGAAATTAGTTTTATCATTCGTGTCCGAAAACCCCTTTCGACATCCGGTCAAACGTCCGATGTGACACCCAAAAATTTTCTTTT[C/T]
GCGAACTAAATACACCCTTATTTTCCATGAGCATGTATCCTGAATTGCCAAATAGTGTGCTTCGTGAAAAAACTTTATATATAAAAGTTTCTTGAAAAAA

Reverse complement sequence

TTTTTTCAAGAAACTTTTATATATAAAGTTTTTTCACGAAGCACACTATTTGGCAATTCAGGATACATGCTCATGGAAAATAAGGGTGTATTTAGTTCGC[G/A]
AAAAGAAAATTTTTGGGTGTCACATCGGACGTTTGACCGGATGTCGAAAGGGGTTTTCGGACACGAATGATAAAACTAATTTCATAACTCACCTGGGAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.90% 0.08% 0.00% NA
All Indica  2759 99.40% 0.50% 0.11% 0.00% NA
All Japonica  1512 87.40% 12.50% 0.07% 0.00% NA
Aus  269 75.10% 24.90% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 99.00% 0.80% 0.25% 0.00% NA
Temperate Japonica  767 96.50% 3.50% 0.00% 0.00% NA
Tropical Japonica  504 73.00% 26.80% 0.20% 0.00% NA
Japonica Intermediate  241 88.80% 11.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431489327 C -> T LOC_Os04g52870.1 upstream_gene_variant ; 786.0bp to feature; MODIFIER silent_mutation Average:82.11; most accessible tissue: Minghui63 panicle, score: 96.84 N N N N
vg0431489327 C -> T LOC_Os04g52880.1 upstream_gene_variant ; 3419.0bp to feature; MODIFIER silent_mutation Average:82.11; most accessible tissue: Minghui63 panicle, score: 96.84 N N N N
vg0431489327 C -> T LOC_Os04g52870-LOC_Os04g52880 intergenic_region ; MODIFIER silent_mutation Average:82.11; most accessible tissue: Minghui63 panicle, score: 96.84 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431489327 C T -0.01 -0.01 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431489327 NA 1.78E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 2.04E-06 mr1233 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 6.49E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 8.32E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 3.93E-06 NA mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 1.86E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 5.13E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 1.04E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 2.90E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 1.84E-08 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 6.36E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 8.27E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 9.31E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 2.31E-07 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 5.94E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 NA 6.86E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 5.23E-08 NA mr1800_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431489327 4.01E-09 1.34E-14 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251