Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431387810:

Variant ID: vg0431387810 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31387810
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTCCATTAAGAGCGAGGCTAATAATATAGCTGACTTGTTGGCTATAAGATTTTTTTAAGACTTCTCTCAGTCCATCCATATAATAATTAGCTCTTTA[C/A,T]
GATTAATATAGGACACTTGTCTCTCACACAGAGTTTTTTGGTTCTTGTGTCTAAGCCGACTGTAAATTTACAGACCGCTTCTCTTCTCTTTTCTCCTCCA

Reverse complement sequence

TGGAGGAGAAAAGAGAAGAGAAGCGGTCTGTAAATTTACAGTCGGCTTAGACACAAGAACCAAAAAACTCTGTGTGAGAGACAAGTGTCCTATATTAATC[G/T,A]
TAAAGAGCTAATTATTATATGGATGGACTGAGAGAAGTCTTAAAAAAATCTTATAGCCAACAAGTCAGCTATATTATTAGCCTCGCTCTTAATGGAGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.40% 20.50% 0.15% 0.00% T: 0.02%
All Indica  2759 92.20% 7.70% 0.11% 0.00% NA
All Japonica  1512 61.10% 38.60% 0.26% 0.00% NA
Aus  269 62.10% 37.50% 0.00% 0.00% T: 0.37%
Indica I  595 95.10% 4.70% 0.17% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 90.00% 10.00% 0.00% 0.00% NA
Indica Intermediate  786 88.80% 11.10% 0.13% 0.00% NA
Temperate Japonica  767 88.70% 10.80% 0.52% 0.00% NA
Tropical Japonica  504 25.20% 74.80% 0.00% 0.00% NA
Japonica Intermediate  241 48.50% 51.50% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431387810 C -> A LOC_Os04g52710.1 upstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:81.285; most accessible tissue: Minghui63 young leaf, score: 92.335 N N N N
vg0431387810 C -> A LOC_Os04g52710.2 upstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:81.285; most accessible tissue: Minghui63 young leaf, score: 92.335 N N N N
vg0431387810 C -> A LOC_Os04g52710.3 upstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:81.285; most accessible tissue: Minghui63 young leaf, score: 92.335 N N N N
vg0431387810 C -> A LOC_Os04g52700-LOC_Os04g52710 intergenic_region ; MODIFIER silent_mutation Average:81.285; most accessible tissue: Minghui63 young leaf, score: 92.335 N N N N
vg0431387810 C -> T LOC_Os04g52710.1 upstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:81.285; most accessible tissue: Minghui63 young leaf, score: 92.335 N N N N
vg0431387810 C -> T LOC_Os04g52710.2 upstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:81.285; most accessible tissue: Minghui63 young leaf, score: 92.335 N N N N
vg0431387810 C -> T LOC_Os04g52710.3 upstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:81.285; most accessible tissue: Minghui63 young leaf, score: 92.335 N N N N
vg0431387810 C -> T LOC_Os04g52700-LOC_Os04g52710 intergenic_region ; MODIFIER silent_mutation Average:81.285; most accessible tissue: Minghui63 young leaf, score: 92.335 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431387810 C A 0.02 0.01 0.01 0.01 0.0 0.0
vg0431387810 C T 0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431387810 NA 2.50E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431387810 NA 2.40E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 4.50E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 2.63E-06 NA mr1115_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 2.22E-16 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 7.33E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 1.54E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 1.94E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 5.37E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 1.09E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 7.07E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 1.74E-08 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 8.53E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 1.72E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 3.43E-07 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 4.07E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 1.36E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 7.88E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 2.90E-06 2.89E-06 mr1777_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431387810 NA 5.44E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251