Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431306962:

Variant ID: vg0431306962 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31306962
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.08, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TGCGCCTGCTGCCCTAGCTTCGCGAACACCGCGTTCAGCGCCGCCGCTGCAAATGCAAATACACCACCACATCCCAAGTAGTAAGTGATGGGGGCATATG[T/A]
CTTCTCGACCGTCCGATGGCCCAGGCCGAGATGATCGGACGGCCAGGAATAGGTGACTGCGCTAAAAGCTAAAAGCCATTTTTTTTTGGAAAAAAAATAC

Reverse complement sequence

GTATTTTTTTTCCAAAAAAAAATGGCTTTTAGCTTTTAGCGCAGTCACCTATTCCTGGCCGTCCGATCATCTCGGCCTGGGCCATCGGACGGTCGAGAAG[A/T]
CATATGCCCCCATCACTTACTACTTGGGATGTGGTGGTGTATTTGCATTTGCAGCGGCGGCGCTGAACGCGGTGTTCGCGAAGCTAGGGCAGCAGGCGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.10% 0.32% 0.00% NA
All Indica  2759 70.80% 28.90% 0.25% 0.00% NA
All Japonica  1512 51.80% 48.10% 0.13% 0.00% NA
Aus  269 96.30% 2.60% 1.12% 0.00% NA
Indica I  595 84.70% 15.10% 0.17% 0.00% NA
Indica II  465 40.60% 58.70% 0.65% 0.00% NA
Indica III  913 82.50% 17.50% 0.00% 0.00% NA
Indica Intermediate  786 64.60% 35.00% 0.38% 0.00% NA
Temperate Japonica  767 21.00% 78.90% 0.13% 0.00% NA
Tropical Japonica  504 87.30% 12.50% 0.20% 0.00% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431306962 T -> A LOC_Os04g52630.1 downstream_gene_variant ; 1787.0bp to feature; MODIFIER silent_mutation Average:98.111; most accessible tissue: Callus, score: 99.385 N N N N
vg0431306962 T -> A LOC_Os04g52614.1 intron_variant ; MODIFIER silent_mutation Average:98.111; most accessible tissue: Callus, score: 99.385 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431306962 T A 0.07 0.09 0.05 0.04 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431306962 NA 1.04E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431306962 NA 4.57E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431306962 NA 9.35E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 1.76E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 6.09E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 1.50E-08 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 3.91E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 8.87E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 6.88E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 6.40E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 4.70E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 2.92E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 9.08E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 9.64E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 8.75E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 6.18E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 7.13E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 1.11E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 1.70E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 9.65E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 4.42E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 3.04E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 5.38E-09 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 4.49E-08 mr1448_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 1.56E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 6.66E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 5.95E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 1.05E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 9.66E-11 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431306962 NA 6.57E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251