Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430612645:

Variant ID: vg0430612645 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30612645
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTTTGATGTGATGGAAAGTTGTAAGTTTAGAAAAAAAAACTTTGGAACTAAGGTTGTGTTTAGTTCAGCGCAAAGTTTGGATTTTGGTTGAAATTGGG[G/A]
ATGATGTGACTGAAAAGTTGTGTATGTATGACAGTTTGATGTGATGGAAAAAGACTGAAGTTTGGATCCAAACTTTAGATCTAAACACAGCCTAAACACA

Reverse complement sequence

TGTGTTTAGGCTGTGTTTAGATCTAAAGTTTGGATCCAAACTTCAGTCTTTTTCCATCACATCAAACTGTCATACATACACAACTTTTCAGTCACATCAT[C/T]
CCCAATTTCAACCAAAATCCAAACTTTGCGCTGAACTAAACACAACCTTAGTTCCAAAGTTTTTTTTTCTAAACTTACAACTTTCCATCACATCAAACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 36.60% 1.31% 11.64% NA
All Indica  2759 62.40% 34.90% 1.12% 1.59% NA
All Japonica  1512 38.80% 39.80% 1.72% 19.71% NA
Aus  269 11.90% 13.00% 0.37% 74.72% NA
Indica I  595 44.50% 53.80% 1.01% 0.67% NA
Indica II  465 76.60% 22.20% 0.86% 0.43% NA
Indica III  913 63.40% 34.70% 0.99% 0.88% NA
Indica Intermediate  786 66.40% 28.20% 1.53% 3.82% NA
Temperate Japonica  767 62.70% 30.90% 2.09% 4.30% NA
Tropical Japonica  504 8.50% 59.50% 1.39% 30.56% NA
Japonica Intermediate  241 25.70% 27.00% 1.24% 46.06% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 45.60% 42.20% 4.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430612645 G -> DEL N N silent_mutation Average:75.458; most accessible tissue: Minghui63 root, score: 94.021 N N N N
vg0430612645 G -> A LOC_Os04g51660.1 upstream_gene_variant ; 2239.0bp to feature; MODIFIER silent_mutation Average:75.458; most accessible tissue: Minghui63 root, score: 94.021 N N N N
vg0430612645 G -> A LOC_Os04g51650.1 downstream_gene_variant ; 4691.0bp to feature; MODIFIER silent_mutation Average:75.458; most accessible tissue: Minghui63 root, score: 94.021 N N N N
vg0430612645 G -> A LOC_Os04g51680.1 downstream_gene_variant ; 3315.0bp to feature; MODIFIER silent_mutation Average:75.458; most accessible tissue: Minghui63 root, score: 94.021 N N N N
vg0430612645 G -> A LOC_Os04g51660-LOC_Os04g51680 intergenic_region ; MODIFIER silent_mutation Average:75.458; most accessible tissue: Minghui63 root, score: 94.021 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430612645 G A -0.03 -0.01 -0.02 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430612645 NA 2.97E-08 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 NA 4.70E-07 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 3.98E-12 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 3.29E-06 1.02E-08 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 8.46E-09 NA mr1064_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 NA 7.63E-07 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 NA 7.44E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 NA 1.74E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 NA 9.28E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 3.40E-18 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612645 4.74E-11 1.54E-14 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251