Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430570531:

Variant ID: vg0430570531 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30570531
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAGTCAAAGTTGGACACGGAAACCCAGAGTTTGCCTTTTTTGGTGACGGAGGGAGTACTGACTTAGGTGGTGTTTAGATCCAGTGACTTAACTTTAGTC[C/T]
CTGTCTTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTACATAAATAAAAGCTAATTCACGAGACAAATTTTTTAAGCCTAAT

Reverse complement sequence

ATTAGGCTTAAAAAATTTGTCTCGTGAATTAGCTTTTATTTATGTAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAAGACAG[G/A]
GACTAAAGTTAAGTCACTGGATCTAAACACCACCTAAGTCAGTACTCCCTCCGTCACCAAAAAAGGCAAACTCTGGGTTTCCGTGTCCAACTTTGACTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.50% 4.30% 1.63% 49.62% NA
All Indica  2759 35.00% 0.10% 1.45% 63.50% NA
All Japonica  1512 63.30% 13.10% 2.12% 21.49% NA
Aus  269 13.40% 0.00% 1.12% 85.50% NA
Indica I  595 53.60% 0.00% 0.00% 46.39% NA
Indica II  465 25.80% 0.00% 4.30% 69.89% NA
Indica III  913 32.00% 0.10% 0.44% 67.47% NA
Indica Intermediate  786 29.80% 0.10% 2.04% 68.07% NA
Temperate Japonica  767 67.70% 24.10% 3.52% 4.69% NA
Tropical Japonica  504 65.10% 0.80% 0.40% 33.73% NA
Japonica Intermediate  241 45.60% 3.70% 1.24% 49.38% NA
VI/Aromatic  96 94.80% 3.10% 1.04% 1.04% NA
Intermediate  90 57.80% 0.00% 1.11% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430570531 C -> DEL N N silent_mutation Average:72.884; most accessible tissue: Minghui63 flag leaf, score: 94.85 N N N N
vg0430570531 C -> T LOC_Os04g51590.1 downstream_gene_variant ; 2260.0bp to feature; MODIFIER silent_mutation Average:72.884; most accessible tissue: Minghui63 flag leaf, score: 94.85 N N N N
vg0430570531 C -> T LOC_Os04g51610.1 downstream_gene_variant ; 1564.0bp to feature; MODIFIER silent_mutation Average:72.884; most accessible tissue: Minghui63 flag leaf, score: 94.85 N N N N
vg0430570531 C -> T LOC_Os04g51610.3 downstream_gene_variant ; 1564.0bp to feature; MODIFIER silent_mutation Average:72.884; most accessible tissue: Minghui63 flag leaf, score: 94.85 N N N N
vg0430570531 C -> T LOC_Os04g51600.1 intron_variant ; MODIFIER silent_mutation Average:72.884; most accessible tissue: Minghui63 flag leaf, score: 94.85 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430570531 C T -0.02 -0.01 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430570531 2.93E-08 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 4.34E-06 7.09E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 9.58E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 NA 8.90E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 NA 1.87E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 2.14E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 NA 2.68E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 NA 4.40E-06 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 NA 7.91E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 NA 5.20E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430570531 NA 2.68E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251