Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430478309:

Variant ID: vg0430478309 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30478309
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGGAGAGACGAGTCGGGGAGTAGAGAAGGCGAGCCGCCGTCGCTGAGGAGTGACGAGCTGGGGAATGGAGAAGATGCGCCGCCGTCGCGGGGAGAGAA[A/G]
GCGTGCAGCCGTCGTGAGGAGTGAAGAAGGCGCGGAGAGGGAGAAGGTGCGCCGCCATTGCTGGGAGTGGTGAGAAAAGAAGTGGAGAAGGCATGCCGCC

Reverse complement sequence

GGCGGCATGCCTTCTCCACTTCTTTTCTCACCACTCCCAGCAATGGCGGCGCACCTTCTCCCTCTCCGCGCCTTCTTCACTCCTCACGACGGCTGCACGC[T/C]
TTCTCTCCCCGCGACGGCGGCGCATCTTCTCCATTCCCCAGCTCGTCACTCCTCAGCGACGGCGGCTCGCCTTCTCTACTCCCCGACTCGTCTCTCCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 14.40% 0.28% 18.28% NA
All Indica  2759 91.60% 0.90% 0.11% 7.39% NA
All Japonica  1512 22.60% 41.50% 0.33% 35.58% NA
Aus  269 90.30% 1.90% 0.00% 7.81% NA
Indica I  595 98.00% 0.50% 0.00% 1.51% NA
Indica II  465 83.40% 2.40% 0.43% 13.76% NA
Indica III  913 92.40% 0.40% 0.00% 7.12% NA
Indica Intermediate  786 90.60% 0.90% 0.13% 8.40% NA
Temperate Japonica  767 5.90% 61.50% 0.13% 32.46% NA
Tropical Japonica  504 34.90% 15.70% 0.60% 48.81% NA
Japonica Intermediate  241 50.20% 31.50% 0.41% 17.84% NA
VI/Aromatic  96 8.30% 6.20% 1.04% 84.38% NA
Intermediate  90 54.40% 18.90% 4.44% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430478309 A -> DEL LOC_Os04g51454.1 N frameshift_variant Average:94.497; most accessible tissue: Zhenshan97 flag leaf, score: 98.636 N N N N
vg0430478309 A -> G LOC_Os04g51454.1 missense_variant ; p.Leu32Pro; MODERATE nonsynonymous_codon ; L32P Average:94.497; most accessible tissue: Zhenshan97 flag leaf, score: 98.636 unknown unknown TOLERATED 0.25

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430478309 A G 0.0 -0.02 -0.03 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430478309 NA 6.02E-08 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 9.05E-06 NA mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 NA 8.32E-09 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 4.69E-12 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 3.75E-06 1.28E-10 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 NA 6.17E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 1.59E-07 NA mr1064_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 5.31E-08 5.75E-13 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 NA 4.64E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 NA 6.02E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 NA 7.56E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 NA 3.61E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 6.90E-18 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 3.46E-11 1.26E-19 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430478309 NA 8.59E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251