Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430364199:

Variant ID: vg0430364199 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30364199
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

AGAATGTACGTGCATGCTTTTATATCAGTAAGTACATGCGCGTTTGCATAAGCATATGCATCGGGAACTTAATCTATATACACAAGTCTTCCCGTGTACA[T/C]
ACCGTACATACCAACTTAAAAACATATCATAAAATATTCTATACAGAATTGTACAGGTACTTTTAGTAGTATTATATCTATGAGCAAAGTTTCATTTTCA

Reverse complement sequence

TGAAAATGAAACTTTGCTCATAGATATAATACTACTAAAAGTACCTGTACAATTCTGTATAGAATATTTTATGATATGTTTTTAAGTTGGTATGTACGGT[A/G]
TGTACACGGGAAGACTTGTGTATATAGATTAAGTTCCCGATGCATATGCTTATGCAAACGCGCATGTACTTACTGATATAAAAGCATGCACGTACATTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.10%	30.80%	0.04%	0.00%	NA
All Indica	2759	98.00%	2.00%	0.04%	0.00%	NA
All Japonica	1512	9.70%	90.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.50%	2.50%	0.00%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	2.50%	0.13%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	16.10%	83.90%	0.00%	0.00%	NA
Japonica Intermediate	241	15.40%	84.60%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430364199	T -> C	LOC_Os04g51240.1	upstream_gene_variant ; 541.0bp to feature; MODIFIER	silent_mutation	Average:66.81; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0430364199	T -> C	LOC_Os04g51250.1	downstream_gene_variant ; 1730.0bp to feature; MODIFIER	silent_mutation	Average:66.81; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0430364199	T -> C	LOC_Os04g51240-LOC_Os04g51250	intergenic_region ; MODIFIER	silent_mutation	Average:66.81; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430364199	NA	3.14E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	8.62E-09	NA	mr1301	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	1.99E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	4.22E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	6.66E-105	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	2.94E-99	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	6.98E-32	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	2.64E-07	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	2.09E-11	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	2.69E-65	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	2.32E-59	mr1599_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	4.67E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	1.54E-27	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	2.75E-29	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	3.82E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	1.59E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	8.45E-33	mr1780_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	1.47E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	1.80E-31	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199	NA	2.76E-07	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251