Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430105040:

Variant ID: vg0430105040 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30105040
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGCAAACTAAAATACGAGAATTAAAATAAGTAATATTGAAAGAATAGTCCATCTAAAACCCAACATTATATTAAATAAATTTTCAAATAAAATAAAAT[G/A]
AATTCTAAAATTGGATTTTCAATACAAATTCCAAAGACCCCACGAAGTTAACCCCTCACTTCCCCTTTTATACTGAGTTCGGTTATTCACTTTCCCAACT

Reverse complement sequence

AGTTGGGAAAGTGAATAACCGAACTCAGTATAAAAGGGGAAGTGAGGGGTTAACTTCGTGGGGTCTTTGGAATTTGTATTGAAAATCCAATTTTAGAATT[C/T]
ATTTTATTTTATTTGAAAATTTATTTAATATAATGTTGGGTTTTAGATGGACTATTCTTTCAATATTACTTATTTTAATTCTCGTATTTTAGTTTGCTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.30%	0.40%	1.27%	0.00%	NA
All Indica	2759	99.80%	0.00%	0.14%	0.00%	NA
All Japonica	1512	95.20%	1.10%	3.64%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	91.30%	2.10%	6.65%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	98.30%	0.40%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430105040	G -> A	LOC_Os04g50880.1	downstream_gene_variant ; 2168.0bp to feature; MODIFIER	silent_mutation	Average:39.859; most accessible tissue: Callus, score: 79.217	N	N	N	N
vg0430105040	G -> A	LOC_Os04g50890.1	downstream_gene_variant ; 4931.0bp to feature; MODIFIER	silent_mutation	Average:39.859; most accessible tissue: Callus, score: 79.217	N	N	N	N
vg0430105040	G -> A	LOC_Os04g50870-LOC_Os04g50880	intergenic_region ; MODIFIER	silent_mutation	Average:39.859; most accessible tissue: Callus, score: 79.217	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430105040	7.88E-06	7.88E-06	mr1200	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430105040	NA	4.87E-06	mr1441	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430105040	7.91E-07	7.91E-07	mr1855	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251