Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430036961:

Variant ID: vg0430036961 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30036961
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.46, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AACCGTAGTACGGCTCGCGCGGCGCCGGTAGCGGAGTACGAGAGGGACACACGTACGTGTGTGCCGCTACGACATTCTGATGCATGGCTTCTGCTGCTGA[T/C]
ACAGGCGGCGGTTTCGAGCGTGTCGTGTCCCGGTGTTCGTCCAGTACGTGACCTGCTGCCTGCAGCTTCAAGAAGGTCTCGCTCGCGCGGCGTGGGTTTC

Reverse complement sequence

GAAACCCACGCCGCGCGAGCGAGACCTTCTTGAAGCTGCAGGCAGCAGGTCACGTACTGGACGAACACCGGGACACGACACGCTCGAAACCGCCGCCTGT[A/G]
TCAGCAGCAGAAGCCATGCATCAGAATGTCGTAGCGGCACACACGTACGTGTGTCCCTCTCGTACTCCGCTACCGGCGCCGCGCGAGCCGTACTACGGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 46.40% 2.58% 0.15% NA
All Indica  2759 55.30% 44.00% 0.54% 0.22% NA
All Japonica  1512 53.60% 39.70% 6.61% 0.00% NA
Aus  269 11.90% 88.10% 0.00% 0.00% NA
Indica I  595 76.30% 23.40% 0.34% 0.00% NA
Indica II  465 22.80% 76.30% 0.43% 0.43% NA
Indica III  913 56.70% 42.70% 0.44% 0.11% NA
Indica Intermediate  786 56.90% 41.90% 0.89% 0.38% NA
Temperate Japonica  767 71.40% 16.00% 12.52% 0.00% NA
Tropical Japonica  504 14.30% 85.30% 0.40% 0.00% NA
Japonica Intermediate  241 79.30% 19.90% 0.83% 0.00% NA
VI/Aromatic  96 5.20% 91.70% 3.12% 0.00% NA
Intermediate  90 33.30% 61.10% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430036961 T -> C LOC_Os04g50770-LOC_Os04g50780 intergenic_region ; MODIFIER silent_mutation Average:84.752; most accessible tissue: Zhenshan97 flower, score: 91.289 N N N N
vg0430036961 T -> DEL N N silent_mutation Average:84.752; most accessible tissue: Zhenshan97 flower, score: 91.289 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430036961 T C 0.09 0.06 0.01 0.03 0.09 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430036961 NA 3.02E-07 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 1.63E-07 5.37E-13 mr1174 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 9.23E-08 4.12E-16 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 2.62E-08 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 4.60E-10 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 6.40E-06 mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 1.53E-06 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 2.62E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 9.55E-10 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 4.26E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 3.89E-10 1.44E-14 mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 9.17E-09 2.99E-20 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 6.86E-09 5.74E-14 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 3.62E-09 4.99E-21 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 2.81E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 7.18E-07 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 1.85E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 9.35E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 2.19E-11 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430036961 NA 8.19E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251