Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429933325:

Variant ID: vg0429933325 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29933325
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


CCGCTTGAACAATTTCAACATCATCGCCGTCCCATTGAATTAAACATTGATGCAAGGTAGAAGGCATACAACAATTGGCATGAATCCAACAACGACCCAA[A/T]
ATAACATTGTAGTTACCTTGCACATCGACGATGAAAAAGCGGTTGGTAGCGTCCTGTTTCCCACGGTGAGCTCCGCCGAAAAAATACCCTTCGCCTCCGT

Reverse complement sequence

ACGGAGGCGAAGGGTATTTTTTCGGCGGAGCTCACCGTGGGAAACAGGACGCTACCAACCGCTTTTTCATCGTCGATGTGCAAGGTAACTACAATGTTAT[T/A]
TTGGGTCGTTGTTGGATTCATGCCAATTGTTGTATGCCTTCTACCTTGCATCAATGTTTAATTCAATGGGACGGCGATGATGTTGAAATTGTTCAAGCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 15.70% 0.19% 0.00% NA
All Indica  2759 73.30% 26.40% 0.29% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.70% 18.20% 0.17% 0.00% NA
Indica II  465 34.60% 64.70% 0.65% 0.00% NA
Indica III  913 84.00% 15.90% 0.11% 0.00% NA
Indica Intermediate  786 77.50% 22.10% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429933325 A -> T LOC_Os04g50172.1 missense_variant ; p.Phe765Tyr; MODERATE nonsynonymous_codon ; F765Y Average:38.471; most accessible tissue: Minghui63 root, score: 45.031 unknown unknown TOLERATED 0.56

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429933325 NA 6.01E-13 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 NA 8.47E-08 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 3.25E-08 1.78E-23 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 7.61E-08 3.27E-15 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 1.86E-12 1.08E-27 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 1.41E-14 2.23E-26 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 5.12E-11 3.78E-16 mr1347 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 4.61E-11 2.19E-17 mr1347 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 NA 7.41E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 NA 8.15E-09 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 5.34E-08 2.31E-07 mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 6.47E-08 1.51E-10 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 NA 4.55E-14 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 NA 4.26E-08 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 3.03E-11 3.64E-29 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 5.86E-14 3.69E-29 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 1.65E-12 6.04E-24 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 2.59E-11 5.76E-26 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 NA 1.14E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 NA 2.44E-11 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 3.70E-06 2.93E-07 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 2.15E-06 3.00E-09 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 NA 3.53E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429933325 NA 2.34E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251