Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429156078:

Variant ID: vg0429156078 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 29156078
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTATTTGTACCGTTTCATAAGGCTATTTACAATGCTCATAGGTGACGTTCAGCCTCAACCATCTACGTCGAAAATTCGGCGCCATGTACATATCTGCC[A/G]
TTCCCAACTGAAGATCACGGAGCCTAAACGAAGCAACCCGTTCTTCGTCAGAACTGGCAAGCGTGGGGCAAGACGCGGGGCGCATTGAGAGGGGGCATGG

Reverse complement sequence

CCATGCCCCCTCTCAATGCGCCCCGCGTCTTGCCCCACGCTTGCCAGTTCTGACGAAGAACGGGTTGCTTCGTTTAGGCTCCGTGATCTTCAGTTGGGAA[T/C]
GGCAGATATGTACATGGCGCCGAATTTTCGACGTAGATGGTTGAGGCTGAACGTCACCTATGAGCATTGTAAATAGCCTTATGAAACGGTACAAATACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.30%	32.30%	0.02%	0.38%	NA
All Indica	2759	85.40%	14.00%	0.04%	0.54%	NA
All Japonica	1512	31.70%	68.30%	0.00%	0.00%	NA
Aus	269	72.90%	27.10%	0.00%	0.00%	NA
Indica I	595	99.30%	0.20%	0.00%	0.50%	NA
Indica II	465	97.80%	1.90%	0.00%	0.22%	NA
Indica III	913	67.90%	31.50%	0.00%	0.55%	NA
Indica Intermediate	786	87.90%	11.20%	0.13%	0.76%	NA
Temperate Japonica	767	15.90%	84.10%	0.00%	0.00%	NA
Tropical Japonica	504	39.30%	60.70%	0.00%	0.00%	NA
Japonica Intermediate	241	66.00%	34.00%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	68.90%	27.80%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0429156078	A -> DEL	N	N	silent_mutation	Average:90.631; most accessible tissue: Minghui63 flag leaf, score: 98.68	N	N	N	N
vg0429156078	A -> G	LOC_Os04g48880.1	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:90.631; most accessible tissue: Minghui63 flag leaf, score: 98.68	N	N	N	N
vg0429156078	A -> G	LOC_Os04g48870.1	downstream_gene_variant ; 2118.0bp to feature; MODIFIER	silent_mutation	Average:90.631; most accessible tissue: Minghui63 flag leaf, score: 98.68	N	N	N	N
vg0429156078	A -> G	LOC_Os04g48890.1	downstream_gene_variant ; 4803.0bp to feature; MODIFIER	silent_mutation	Average:90.631; most accessible tissue: Minghui63 flag leaf, score: 98.68	N	N	N	N
vg0429156078	A -> G	LOC_Os04g48870-LOC_Os04g48880	intergenic_region ; MODIFIER	silent_mutation	Average:90.631; most accessible tissue: Minghui63 flag leaf, score: 98.68	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0429156078	A	G	0.07	0.03	0.04	0.03	0.06	0.1

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0429156078	NA	2.92E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	3.88E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	6.06E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	2.63E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	3.58E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	1.32E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	6.48E-08	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	1.47E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	2.05E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	2.25E-06	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	4.89E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	6.03E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	NA	1.56E-06	mr1729_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429156078	5.55E-06	2.61E-11	mr1788_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251