Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429103995:

Variant ID: vg0429103995 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29103995
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGACACAAACTGACAGCGGATCGGATATGGGGGGGGGGGGGGGGGGGGGGGCATCGTCCGGGTAATAATCCAATATCCAAGCCCCTCCACTCCACTCGC[A/G]
ATGTAATGTTTTAAGACCTGTTTCTTTCGGCTTGGAATTATTATAATCTAGATTATTGAGTCAGATTACTGTAATAGAATAAGCGGTTAGTTGTTTCTTT

Reverse complement sequence

AAAGAAACAACTAACCGCTTATTCTATTACAGTAATCTGACTCAATAATCTAGATTATAATAATTCCAAGCCGAAAGAAACAGGTCTTAAAACATTACAT[T/C]
GCGAGTGGAGTGGAGGGGCTTGGATATTGGATTATTACCCGGACGATGCCCCCCCCCCCCCCCCCCCCCCCATATCCGATCCGCTGTCAGTTTGTGTCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.60% 0.19% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 82.70% 16.70% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.50% 0.13% 0.00% NA
Tropical Japonica  504 49.80% 49.00% 1.19% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429103995 A -> G LOC_Os04g48780.1 upstream_gene_variant ; 2528.0bp to feature; MODIFIER silent_mutation Average:91.304; most accessible tissue: Minghui63 root, score: 98.825 N N N N
vg0429103995 A -> G LOC_Os04g48790.1 upstream_gene_variant ; 2046.0bp to feature; MODIFIER silent_mutation Average:91.304; most accessible tissue: Minghui63 root, score: 98.825 N N N N
vg0429103995 A -> G LOC_Os04g48780-LOC_Os04g48790 intergenic_region ; MODIFIER silent_mutation Average:91.304; most accessible tissue: Minghui63 root, score: 98.825 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0429103995 A G 0.01 0.02 0.01 -0.03 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429103995 NA 1.11E-08 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 6.29E-10 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 2.59E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 3.36E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 1.04E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 7.45E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 2.05E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 5.42E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 1.60E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 1.10E-07 NA mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 1.45E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 4.01E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 3.34E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 1.28E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 9.81E-09 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429103995 NA 1.10E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251