Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428520912:

Variant ID: vg0428520912 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28520912
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.14, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TATAAAAAAATTAAAAAAAAGTCGCATAAAGTACTGTTCATGTTTTATCATCTAATCATAAAAATACTAATCATAATAAATTTTAAATAATATAAATGGT[C/T]
AAACATTGAACATGAAAATCTACACTTAAAATGAGACGGAGGGAGTATTTTGGTAGGGAGGGAGTAATTGTTAAGGAAGATTCGGATTCTTCCTTCTACC

Reverse complement sequence

GGTAGAAGGAAGAATCCGAATCTTCCTTAACAATTACTCCCTCCCTACCAAAATACTCCCTCCGTCTCATTTTAAGTGTAGATTTTCATGTTCAATGTTT[G/A]
ACCATTTATATTATTTAAAATTTATTATGATTAGTATTTTTATGATTAGATGATAAAACATGAACAGTACTTTATGCGACTTTTTTTTAATTTTTTTATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.30%	40.10%	0.59%	0.02%	NA
All Indica	2759	94.70%	4.80%	0.47%	0.04%	NA
All Japonica	1512	1.40%	97.80%	0.79%	0.00%	NA
Aus	269	49.80%	50.20%	0.00%	0.00%	NA
Indica I	595	97.10%	2.20%	0.67%	0.00%	NA
Indica II	465	95.10%	4.50%	0.43%	0.00%	NA
Indica III	913	94.40%	5.30%	0.33%	0.00%	NA
Indica Intermediate	786	92.90%	6.50%	0.51%	0.13%	NA
Temperate Japonica	767	0.50%	99.00%	0.52%	0.00%	NA
Tropical Japonica	504	3.00%	96.20%	0.79%	0.00%	NA
Japonica Intermediate	241	0.80%	97.50%	1.66%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	35.60%	61.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428520912	C -> DEL	N	N	silent_mutation	Average:73.54; most accessible tissue: Zhenshan97 flower, score: 88.465	N	N	N	N
vg0428520912	C -> T	LOC_Os04g47970.1	upstream_gene_variant ; 978.0bp to feature; MODIFIER	silent_mutation	Average:73.54; most accessible tissue: Zhenshan97 flower, score: 88.465	N	N	N	N
vg0428520912	C -> T	LOC_Os04g47970.2	upstream_gene_variant ; 978.0bp to feature; MODIFIER	silent_mutation	Average:73.54; most accessible tissue: Zhenshan97 flower, score: 88.465	N	N	N	N
vg0428520912	C -> T	LOC_Os04g47950.1	downstream_gene_variant ; 4777.0bp to feature; MODIFIER	silent_mutation	Average:73.54; most accessible tissue: Zhenshan97 flower, score: 88.465	N	N	N	N
vg0428520912	C -> T	LOC_Os04g47960.1	downstream_gene_variant ; 1127.0bp to feature; MODIFIER	silent_mutation	Average:73.54; most accessible tissue: Zhenshan97 flower, score: 88.465	N	N	N	N
vg0428520912	C -> T	LOC_Os04g47960-LOC_Os04g47970	intergenic_region ; MODIFIER	silent_mutation	Average:73.54; most accessible tissue: Zhenshan97 flower, score: 88.465	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0428520912	C	T	0.01	0.0	-0.01	0.0	-0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428520912	NA	9.64E-27	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	2.63E-39	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	1.63E-27	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	1.04E-30	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	1.02E-23	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	1.15E-12	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	6.36E-30	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	3.62E-40	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	1.10E-47	mr1070_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	8.84E-33	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	1.94E-43	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	3.10E-37	mr1224_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	5.63E-38	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	4.11E-46	mr1437_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	2.31E-35	mr1878_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428520912	NA	7.95E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251