Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428141597:

Variant ID: vg0428141597 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28141597
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGGCCTGACCAGGGACGGCGTGCCATGGCCGGTCTGACCGGCCGCAAGACGGCGGTCTGACCGTCGCATAGGGCCGGTCTGACCGGCGGCACATGAGCG[G/A]
TCAGACCGCCCCCCTAGAGGCCGAGATGATGTTGCTCGGGATGGCCGATATAGAGCCGACGGAGCTGTAGTCGGTCAGACCGAGCCGATGGCAGTCTGAA

Reverse complement sequence

TTCAGACTGCCATCGGCTCGGTCTGACCGACTACAGCTCCGTCGGCTCTATATCGGCCATCCCGAGCAACATCATCTCGGCCTCTAGGGGGGCGGTCTGA[C/T]
CGCTCATGTGCCGCCGGTCAGACCGGCCCTATGCGACGGTCAGACCGCCGTCTTGCGGCCGGTCAGACCGGCCATGGCACGCCGTCCCTGGTCAGGCCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.60%	1.90%	1.50%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.11%	0.00%	NA
All Japonica	1512	90.10%	5.70%	4.23%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	98.30%	1.30%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	92.80%	2.30%	4.82%	0.00%	NA
Tropical Japonica	504	95.40%	3.00%	1.59%	0.00%	NA
Japonica Intermediate	241	70.10%	22.00%	7.88%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	0.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428141597	G -> A	LOC_Os04g47420.1	upstream_gene_variant ; 1692.0bp to feature; MODIFIER	silent_mutation	Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0428141597	G -> A	LOC_Os04g47430.1	upstream_gene_variant ; 1409.0bp to feature; MODIFIER	silent_mutation	Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0428141597	G -> A	LOC_Os04g47440.1	upstream_gene_variant ; 3358.0bp to feature; MODIFIER	silent_mutation	Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0428141597	G -> A	LOC_Os04g47410.5	downstream_gene_variant ; 4812.0bp to feature; MODIFIER	silent_mutation	Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0428141597	G -> A	LOC_Os04g47420-LOC_Os04g47430	intergenic_region ; MODIFIER	silent_mutation	Average:55.649; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428141597	NA	6.17E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597	NA	5.08E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597	NA	3.72E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597	NA	2.10E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597	3.87E-06	3.87E-06	mr1302_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597	NA	1.42E-06	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597	NA	7.62E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428141597	NA	8.20E-06	mr1894_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251