Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428089846:

Variant ID: vg0428089846 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28089846
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGGGATGCATCATAGACTTATTCCAGCCATATAGACAACCCAAAAGAGATAAGGGACTTATTCCATTGAGAAGCAGGATGGGTTGTCATGCTTTTGGGC[C/T]
GGCCGGGCACGGCCCGGCTGACCTCGGCCCAGGTTCAGTTATGCCTGGGCCCTGTAGGGCCGGGCGGCCCGTTTGGCTATCTATAGTTGGACCGGAGCAA

Reverse complement sequence

TTGCTCCGGTCCAACTATAGATAGCCAAACGGGCCGCCCGGCCCTACAGGGCCCAGGCATAACTGAACCTGGGCCGAGGTCAGCCGGGCCGTGCCCGGCC[G/A]
GCCCAAAAGCATGACAACCCATCCTGCTTCTCAATGGAATAAGTCCCTTATCTCTTTTGGGTTGTCTATATGGCTGGAATAAGTCTATGATGCATCCCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.00%	14.90%	1.48%	41.68%	NA
All Indica	2759	8.00%	19.10%	2.50%	70.39%	NA
All Japonica	1512	99.40%	0.30%	0.00%	0.33%	NA
Aus	269	39.00%	61.00%	0.00%	0.00%	NA
Indica I	595	3.40%	22.40%	1.01%	73.28%	NA
Indica II	465	5.40%	5.20%	2.58%	86.88%	NA
Indica III	913	12.50%	17.00%	3.18%	67.36%	NA
Indica Intermediate	786	7.80%	27.50%	2.80%	61.96%	NA
Temperate Japonica	767	99.60%	0.30%	0.00%	0.13%	NA
Tropical Japonica	504	99.20%	0.40%	0.00%	0.40%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	66.70%	6.70%	1.11%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428089846	C -> DEL	N	N	silent_mutation	Average:53.947; most accessible tissue: Callus, score: 77.115	N	N	N	N
vg0428089846	C -> T	LOC_Os04g47320.1	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:53.947; most accessible tissue: Callus, score: 77.115	N	N	N	N
vg0428089846	C -> T	LOC_Os04g47310.1	downstream_gene_variant ; 3996.0bp to feature; MODIFIER	silent_mutation	Average:53.947; most accessible tissue: Callus, score: 77.115	N	N	N	N
vg0428089846	C -> T	LOC_Os04g47310-LOC_Os04g47320	intergenic_region ; MODIFIER	silent_mutation	Average:53.947; most accessible tissue: Callus, score: 77.115	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428089846	NA	2.21E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428089846	NA	7.62E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428089846	NA	7.04E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428089846	NA	1.27E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428089846	2.33E-06	NA	mr1082_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428089846	NA	5.78E-07	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428089846	NA	9.15E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428089846	NA	2.39E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428089846	NA	7.20E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251