Variant ID: vg0427270986 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 27270986 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGATTTTTCTTGAGAGAATCCATTCTATACCACCGAGTTTGTTTGAGTTTAATGATATGCCATCGACATTGTTTCTTTCTATAATATATAATATATTGA[C/T]
GACTTTATCAATTGTTCTATAATATGTCATTGGGCTAGGCCTTATTTTTAAAAATACCCAAAGTACTCTTAGAGATAGAAAATTAACAATTGATTTATCT
AGATAAATCAATTGTTAATTTTCTATCTCTAAGAGTACTTTGGGTATTTTTAAAAATAAGGCCTAGCCCAATGACATATTATAGAACAATTGATAAAGTC[G/A]
TCAATATATTATATATTATAGAAAGAAACAATGTCGATGGCATATCATTAAACTCAAACAAACTCGGTGGTATAGAATGGATTCTCTCAAGAAAAATCAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 75.00% | 22.70% | 2.31% | 0.00% | NA |
All Indica | 2759 | 58.00% | 38.10% | 3.88% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 74.30% | 11.40% | 14.29% | 0.00% | NA |
Indica II | 465 | 13.30% | 85.80% | 0.86% | 0.00% | NA |
Indica III | 913 | 68.00% | 31.20% | 0.77% | 0.00% | NA |
Indica Intermediate | 786 | 60.60% | 38.00% | 1.40% | 0.00% | NA |
Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 81.10% | 16.70% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0427270986 | C -> T | LOC_Os04g46030.1 | upstream_gene_variant ; 2006.0bp to feature; MODIFIER | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 73.329 | N | N | N | N |
vg0427270986 | C -> T | LOC_Os04g46040.1 | upstream_gene_variant ; 859.0bp to feature; MODIFIER | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 73.329 | N | N | N | N |
vg0427270986 | C -> T | LOC_Os04g46050.1 | downstream_gene_variant ; 4229.0bp to feature; MODIFIER | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 73.329 | N | N | N | N |
vg0427270986 | C -> T | LOC_Os04g46050.2 | downstream_gene_variant ; 4229.0bp to feature; MODIFIER | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 73.329 | N | N | N | N |
vg0427270986 | C -> T | LOC_Os04g46050.3 | downstream_gene_variant ; 4229.0bp to feature; MODIFIER | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 73.329 | N | N | N | N |
vg0427270986 | C -> T | LOC_Os04g46030-LOC_Os04g46040 | intergenic_region ; MODIFIER | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 73.329 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0427270986 | NA | 3.22E-12 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427270986 | NA | 1.12E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427270986 | NA | 5.23E-06 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427270986 | NA | 1.49E-06 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427270986 | NA | 4.52E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427270986 | 1.76E-06 | 1.76E-06 | mr1693_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0427270986 | NA | 2.47E-14 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |