Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427270986:

Variant ID: vg0427270986 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27270986
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGATTTTTCTTGAGAGAATCCATTCTATACCACCGAGTTTGTTTGAGTTTAATGATATGCCATCGACATTGTTTCTTTCTATAATATATAATATATTGA[C/T]
GACTTTATCAATTGTTCTATAATATGTCATTGGGCTAGGCCTTATTTTTAAAAATACCCAAAGTACTCTTAGAGATAGAAAATTAACAATTGATTTATCT

Reverse complement sequence

AGATAAATCAATTGTTAATTTTCTATCTCTAAGAGTACTTTGGGTATTTTTAAAAATAAGGCCTAGCCCAATGACATATTATAGAACAATTGATAAAGTC[G/A]
TCAATATATTATATATTATAGAAAGAAACAATGTCGATGGCATATCATTAAACTCAAACAAACTCGGTGGTATAGAATGGATTCTCTCAAGAAAAATCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.00%	22.70%	2.31%	0.00%	NA
All Indica	2759	58.00%	38.10%	3.88%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	74.30%	11.40%	14.29%	0.00%	NA
Indica II	465	13.30%	85.80%	0.86%	0.00%	NA
Indica III	913	68.00%	31.20%	0.77%	0.00%	NA
Indica Intermediate	786	60.60%	38.00%	1.40%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	16.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427270986	C -> T	LOC_Os04g46030.1	upstream_gene_variant ; 2006.0bp to feature; MODIFIER	silent_mutation	Average:38.281; most accessible tissue: Callus, score: 73.329	N	N	N	N
vg0427270986	C -> T	LOC_Os04g46040.1	upstream_gene_variant ; 859.0bp to feature; MODIFIER	silent_mutation	Average:38.281; most accessible tissue: Callus, score: 73.329	N	N	N	N
vg0427270986	C -> T	LOC_Os04g46050.1	downstream_gene_variant ; 4229.0bp to feature; MODIFIER	silent_mutation	Average:38.281; most accessible tissue: Callus, score: 73.329	N	N	N	N
vg0427270986	C -> T	LOC_Os04g46050.2	downstream_gene_variant ; 4229.0bp to feature; MODIFIER	silent_mutation	Average:38.281; most accessible tissue: Callus, score: 73.329	N	N	N	N
vg0427270986	C -> T	LOC_Os04g46050.3	downstream_gene_variant ; 4229.0bp to feature; MODIFIER	silent_mutation	Average:38.281; most accessible tissue: Callus, score: 73.329	N	N	N	N
vg0427270986	C -> T	LOC_Os04g46030-LOC_Os04g46040	intergenic_region ; MODIFIER	silent_mutation	Average:38.281; most accessible tissue: Callus, score: 73.329	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427270986	NA	3.22E-12	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427270986	NA	1.12E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427270986	NA	5.23E-06	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427270986	NA	1.49E-06	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427270986	NA	4.52E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427270986	1.76E-06	1.76E-06	mr1693_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427270986	NA	2.47E-14	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251