Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427140714:

Variant ID: vg0427140714 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27140714
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TCGAAATAAAAATAAAATACAATCTAAAATTAGAAAAGGAAAGGATAGTCCAAGTAGGAATACAATTTAAAAATAGCTGAAATTCGGAATTAAACATAAG[T/C]
AATATTGAAAGAAGTTTCCATATAAGAACCCAATACGAGATTAATACAAATTCGAAATAAAAATAAAATAAAATCTAAAATTAGAAAAGAAAATAGAGTC

Reverse complement sequence

GACTCTATTTTCTTTTCTAATTTTAGATTTTATTTTATTTTTATTTCGAATTTGTATTAATCTCGTATTGGGTTCTTATATGGAAACTTCTTTCAATATT[A/G]
CTTATGTTTAATTCCGAATTTCAGCTATTTTTAAATTGTATTCCTACTTGGACTATCCTTTCCTTTTCTAATTTTAGATTGTATTTTATTTTTATTTCGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	38.60%	0.30%	0.00%	NA
All Indica	2759	38.70%	60.80%	0.51%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	56.50%	43.50%	0.00%	0.00%	NA
Indica I	595	21.80%	77.30%	0.84%	0.00%	NA
Indica II	465	11.40%	88.20%	0.43%	0.00%	NA
Indica III	913	57.20%	42.70%	0.11%	0.00%	NA
Indica Intermediate	786	46.20%	53.10%	0.76%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427140714	T -> C	LOC_Os04g45834.2	downstream_gene_variant ; 1530.0bp to feature; MODIFIER	silent_mutation	Average:30.06; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0427140714	T -> C	LOC_Os04g45834.1	intron_variant ; MODIFIER	silent_mutation	Average:30.06; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0427140714	T -> C	LOC_Os04g45834.3	intron_variant ; MODIFIER	silent_mutation	Average:30.06; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427140714	NA	1.25E-08	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	NA	6.09E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	NA	5.93E-06	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	NA	1.97E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	6.73E-07	6.73E-07	mr1574_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	5.12E-06	NA	mr1661_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	6.05E-06	6.05E-06	mr1693_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	1.14E-06	3.36E-06	mr1762_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	NA	5.14E-06	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	NA	1.77E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	NA	2.78E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427140714	NA	1.39E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251