Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0426020064:

Variant ID: vg0426020064 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 26020064
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTTGGATGTTGTGTAGAAACCATGTCTCATGCAAGACATGGTGTCCTTCTCTTTCCTCATTTATTCACTTGCCACATCAATTTTTTTTATCCTAGGTG[G/A]
CAACTTATTTAATACTATAGACACCATCATATCCATTGGGTTAGGAATGCACTAAGTATATTCCTACGTGCATAGCCAGTAGAAAAGTCACCTAGTGGTG

Reverse complement sequence

CACCACTAGGTGACTTTTCTACTGGCTATGCACGTAGGAATATACTTAGTGCATTCCTAACCCAATGGATATGATGGTGTCTATAGTATTAAATAAGTTG[C/T]
CACCTAGGATAAAAAAAATTGATGTGGCAAGTGAATAAATGAGGAAAGAGAAGGACACCATGTCTTGCATGAGACATGGTTTCTACACAACATCCAAGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.20%	1.70%	0.08%	0.00%	NA
All Indica	2759	97.10%	2.80%	0.14%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.30%	2.50%	0.17%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	96.90%	3.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.50%	4.20%	0.25%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0426020064	G -> A	LOC_Os04g43910.1	downstream_gene_variant ; 3877.0bp to feature; MODIFIER	silent_mutation	Average:88.937; most accessible tissue: Zhenshan97 flower, score: 98.269	N	N	N	N
vg0426020064	G -> A	LOC_Os04g43916.1	downstream_gene_variant ; 3872.0bp to feature; MODIFIER	silent_mutation	Average:88.937; most accessible tissue: Zhenshan97 flower, score: 98.269	N	N	N	N
vg0426020064	G -> A	LOC_Os04g43916.2	downstream_gene_variant ; 3872.0bp to feature; MODIFIER	silent_mutation	Average:88.937; most accessible tissue: Zhenshan97 flower, score: 98.269	N	N	N	N
vg0426020064	G -> A	LOC_Os04g43910-LOC_Os04g43916	intergenic_region ; MODIFIER	silent_mutation	Average:88.937; most accessible tissue: Zhenshan97 flower, score: 98.269	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0426020064	G	A	-0.03	0.02	0.02	0.0	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0426020064	NA	3.86E-06	mr1049	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	5.92E-07	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	3.10E-06	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	1.95E-09	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	2.94E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	1.86E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	8.57E-06	mr1344	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	2.76E-07	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	2.21E-06	2.35E-08	mr1704	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	9.40E-06	mr1646_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	5.67E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	6.65E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	9.52E-06	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426020064	NA	2.82E-07	mr1870_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251