Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425623927:

Variant ID: vg0425623927 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 25623927
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTATCAACAATAAAGTTGTATAACTCATCAAGATCTATAACTTTTACTTTGGTCTTTTTTTCTATATAACATTTTTTGAACAATTTGAATTTGAATTT[A/G]
AAAATATGACAACTTCAAACAATATTTTCAAATACTAAATGATTTCAACTTAAAAAGCCATCAACAACAAAATTGTATAACTCATCAATATCTATAACTT

Reverse complement sequence

AAGTTATAGATATTGATGAGTTATACAATTTTGTTGTTGATGGCTTTTTAAGTTGAAATCATTTAGTATTTGAAAATATTGTTTGAAGTTGTCATATTTT[T/C]
AAATTCAAATTCAAATTGTTCAAAAAATGTTATATAGAAAAAAAGACCAAAGTAAAAGTTATAGATCTTGATGAGTTATACAACTTTATTGTTGATAATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	3.70%	3.05%	0.11%	NA
All Indica	2759	92.40%	4.80%	2.65%	0.14%	NA
All Japonica	1512	99.90%	0.00%	0.13%	0.00%	NA
Aus	269	62.50%	14.10%	23.05%	0.37%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	0.20%	0.86%	0.00%	NA
Indica III	913	82.70%	12.40%	4.60%	0.33%	NA
Indica Intermediate	786	94.10%	2.30%	3.44%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	0.00%	4.17%	0.00%	NA
Intermediate	90	92.20%	4.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0425623927	A -> DEL	N	N	silent_mutation	Average:16.633; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0425623927	A -> G	LOC_Os04g43310.1	upstream_gene_variant ; 4355.0bp to feature; MODIFIER	silent_mutation	Average:16.633; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0425623927	A -> G	LOC_Os04g43324.1	upstream_gene_variant ; 3186.0bp to feature; MODIFIER	silent_mutation	Average:16.633; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0425623927	A -> G	LOC_Os04g43310-LOC_Os04g43324	intergenic_region ; MODIFIER	silent_mutation	Average:16.633; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0425623927	4.34E-07	NA	mr1580_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425623927	5.79E-06	NA	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251