Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425422291:

Variant ID: vg0425422291 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 25422291
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CGACCCGATGATCGCGCCCACCTTCCCCGACGCCGCCGATATCCCGTGGCTCGTCGCATGCAGCCTCGCCGGGTATATCTCCGCCGGCACGATGAACGTC[G/A]
CGAGCTTCGCACCACGTCGTCGTTGTCGTTGTCATCATCGAGGTTGAGAAGCCGCTGCAGGAAGAGGAGTGGTCGGACGACGGTGAGTTCATCGAGCTGG

Reverse complement sequence

CCAGCTCGATGAACTCACCGTCGTCCGACCACTCCTCTTCCTGCAGCGGCTTCTCAACCTCGATGATGACAACGACAACGACGACGTGGTGCGAAGCTCG[C/T]
GACGTTCATCGTGCCGGCGGAGATATACCCGGCGAGGCTGCATGCGACGAGCCACGGGATATCGGCGGCGTCGGGGAAGGTGGGCGCGATCATCGGGTCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	45.20%	1.74%	0.11%	NA
All Indica	2759	83.90%	14.20%	1.78%	0.14%	NA
All Japonica	1512	4.00%	94.60%	1.39%	0.07%	NA
Aus	269	5.60%	92.90%	1.49%	0.00%	NA
Indica I	595	82.70%	13.10%	4.20%	0.00%	NA
Indica II	465	95.10%	3.40%	1.29%	0.22%	NA
Indica III	913	85.30%	14.60%	0.11%	0.00%	NA
Indica Intermediate	786	76.60%	20.90%	2.16%	0.38%	NA
Temperate Japonica	767	0.30%	98.00%	1.69%	0.00%	NA
Tropical Japonica	504	7.50%	91.70%	0.79%	0.00%	NA
Japonica Intermediate	241	8.30%	89.60%	1.66%	0.41%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	41.10%	50.00%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0425422291	G -> DEL	N	N	silent_mutation	Average:62.012; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0425422291	G -> A	LOC_Os04g42960.1	downstream_gene_variant ; 3558.0bp to feature; MODIFIER	silent_mutation	Average:62.012; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0425422291	G -> A	LOC_Os04g42970.1	downstream_gene_variant ; 1375.0bp to feature; MODIFIER	silent_mutation	Average:62.012; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0425422291	G -> A	LOC_Os04g42980.1	downstream_gene_variant ; 1658.0bp to feature; MODIFIER	silent_mutation	Average:62.012; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0425422291	G -> A	LOC_Os04g42980.2	downstream_gene_variant ; 1658.0bp to feature; MODIFIER	silent_mutation	Average:62.012; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N
vg0425422291	G -> A	LOC_Os04g42970-LOC_Os04g42980	intergenic_region ; MODIFIER	silent_mutation	Average:62.012; most accessible tissue: Minghui63 root, score: 77.29	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0425422291	NA	1.03E-09	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425422291	1.47E-06	1.47E-06	mr1260	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425422291	NA	1.27E-07	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425422291	NA	4.89E-09	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251