Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424121172:

Variant ID: vg0424121172 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 24121172
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

AGTGAAAGACCAAAATAATGCAGCCATCGTACAGATCAATGAGACCTTAACTTTGCAATCATCCATCAATTGAACGAAAAATTGAAATCTACAACCATTG[G/A]
CAAGTGATTTACCATAACAAGGAGCAGATGCTCCAAGAACTCGGCGAGTCGGAGCCATCCCAAAGCTTGAGGCAATCACGTCGACAATAGCAGTTTGTGG

Reverse complement sequence

CCACAAACTGCTATTGTCGACGTGATTGCCTCAAGCTTTGGGATGGCTCCGACTCGCCGAGTTCTTGGAGCATCTGCTCCTTGTTATGGTAAATCACTTG[C/T]
CAATGGTTGTAGATTTCAATTTTTCGTTCAATTGATGGATGATTGCAAAGTTAAGGTCTCATTGATCTGTACGATGGCTGCATTATTTTGGTCTTTCACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.30%	4.70%	0.00%	0.00%	NA
All Indica	2759	93.20%	6.80%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	88.50%	11.50%	0.00%	0.00%	NA
Indica I	595	90.90%	9.10%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	90.50%	9.50%	0.00%	0.00%	NA
Indica Intermediate	786	94.50%	5.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0424121172	G -> A	LOC_Os04g40630.1	downstream_gene_variant ; 2956.0bp to feature; MODIFIER	silent_mutation	Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0424121172	G -> A	LOC_Os04g40640.1	downstream_gene_variant ; 4311.0bp to feature; MODIFIER	silent_mutation	Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0424121172	G -> A	LOC_Os04g40630.3	downstream_gene_variant ; 2956.0bp to feature; MODIFIER	silent_mutation	Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0424121172	G -> A	LOC_Os04g40630.4	downstream_gene_variant ; 2956.0bp to feature; MODIFIER	silent_mutation	Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0424121172	G -> A	LOC_Os04g40630.2	downstream_gene_variant ; 2956.0bp to feature; MODIFIER	silent_mutation	Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0424121172	G -> A	LOC_Os04g40630-LOC_Os04g40640	intergenic_region ; MODIFIER	silent_mutation	Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0424121172	NA	9.06E-06	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172	NA	6.94E-06	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172	3.29E-06	1.88E-06	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172	7.90E-06	2.31E-06	mr1648_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172	NA	6.56E-06	mr1660_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172	6.22E-07	6.22E-07	mr1663_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172	NA	1.69E-07	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172	1.24E-07	5.91E-09	mr1708_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172	NA	8.30E-06	mr1768_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251