Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423752653:

Variant ID: vg0423752653 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23752653
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAAGGGAAGTGGAAGCTTAACCTGATACGACGACGAGGCTGTCCCGAAGATGAACCCCTTGGGGAAGCTTCTCCGGCTGACCGGCGGCTCGCCGGCGC[C/T]
ATTGTAGGCGCCGGAAGCGACGACAGCAAGGAGGAGGAACGTGAGGAGAAGGCCACCGGGCATTGCCCCTGCTGCCGCCATGGACAGAAAAAGGAAAAAT

Reverse complement sequence

ATTTTTCCTTTTTCTGTCCATGGCGGCAGCAGGGGCAATGCCCGGTGGCCTTCTCCTCACGTTCCTCCTCCTTGCTGTCGTCGCTTCCGGCGCCTACAAT[G/A]
GCGCCGGCGAGCCGCCGGTCAGCCGGAGAAGCTTCCCCAAGGGGTTCATCTTCGGGACAGCCTCGTCGTCGTATCAGGTTAAGCTTCCACTTCCCTTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 48.80% 0.25% 0.13% NA
All Indica  2759 18.40% 80.90% 0.43% 0.22% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 84.00% 16.00% 0.00% 0.00% NA
Indica I  595 22.70% 76.30% 0.67% 0.34% NA
Indica II  465 6.90% 93.10% 0.00% 0.00% NA
Indica III  913 20.50% 79.20% 0.33% 0.00% NA
Indica Intermediate  786 19.70% 79.10% 0.64% 0.51% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423752653 C -> DEL LOC_Os04g39880.1 N frameshift_variant Average:82.872; most accessible tissue: Zhenshan97 young leaf, score: 96.311 N N N N
vg0423752653 C -> DEL LOC_Os04g39880.2 N frameshift_variant Average:82.872; most accessible tissue: Zhenshan97 young leaf, score: 96.311 N N N N
vg0423752653 C -> T LOC_Os04g39880.1 missense_variant ; p.Gly28Ser; MODERATE nonsynonymous_codon ; G28S Average:82.872; most accessible tissue: Zhenshan97 young leaf, score: 96.311 unknown unknown TOLERATED 0.67
vg0423752653 C -> T LOC_Os04g39880.2 missense_variant ; p.Gly28Ser; MODERATE nonsynonymous_codon ; G28S Average:82.872; most accessible tissue: Zhenshan97 young leaf, score: 96.311 unknown unknown TOLERATED 0.41

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0423752653 C T -0.01 0.04 0.05 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423752653 NA 3.70E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423752653 NA 9.84E-12 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423752653 9.32E-06 NA mr1128_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423752653 NA 3.52E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251