Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423636908:

Variant ID: vg0423636908 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23636908
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AGATATCCTCTTTAAAAAGTAGTTTAGTTCCATCTGCTATAGCTTGAAGCAGTCCCGGGGGCCAGCATATTCAGGACCAATACGTTGTTGTATCGATGCG[A/G]
ATATTTCTCTTTCTAACCACACAATTACGAGTACTTCTATTGTGATTCCCAGTAAGAGGGTCAAAATGGGTAGAATCCATATCAGTCCATAGACTTCTTT

Reverse complement sequence

AAAGAAGTCTATGGACTGATATGGATTCTACCCATTTTGACCCTCTTACTGGGAATCACAATAGAAGTACTCGTAATTGTGTGGTTAGAAAGAGAAATAT[T/C]
CGCATCGATACAACAACGTATTGGTCCTGAATATGCTGGCCCCCGGGACTGCTTCAAGCTATAGCAGATGGAACTAAACTACTTTTTAAAGAGGATATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 8.50% 1.59% 0.00% NA
All Indica  2759 99.30% 0.40% 0.36% 0.00% NA
All Japonica  1512 71.00% 24.70% 4.23% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 97.50% 1.30% 1.18% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.10% 0.38% 0.00% NA
Temperate Japonica  767 49.90% 43.30% 6.78% 0.00% NA
Tropical Japonica  504 97.80% 0.80% 1.39% 0.00% NA
Japonica Intermediate  241 82.20% 15.80% 2.07% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423636908 A -> G LOC_Os04g39660.1 upstream_gene_variant ; 4918.0bp to feature; MODIFIER silent_mutation Average:25.096; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0423636908 A -> G LOC_Os04g39680.1 upstream_gene_variant ; 3945.0bp to feature; MODIFIER silent_mutation Average:25.096; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0423636908 A -> G LOC_Os04g39670.1 downstream_gene_variant ; 1637.0bp to feature; MODIFIER silent_mutation Average:25.096; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0423636908 A -> G LOC_Os04g39670-LOC_Os04g39680 intergenic_region ; MODIFIER silent_mutation Average:25.096; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423636908 NA 9.24E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423636908 NA 8.71E-13 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423636908 NA 1.66E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423636908 NA 1.98E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 1.20E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 7.37E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 1.42E-06 2.46E-11 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 6.43E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 1.24E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 3.50E-10 mr1045_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 2.47E-07 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 4.26E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 4.89E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 5.12E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 2.57E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 1.47E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 7.65E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 2.15E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 7.13E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 4.68E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 5.27E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 1.02E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 2.39E-06 1.12E-07 mr1596_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 8.01E-09 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 2.43E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 4.14E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 1.63E-12 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 4.31E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 3.18E-19 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423636908 NA 5.53E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251