Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421592215:

Variant ID: vg0421592215 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21592215
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


CTGATGAGTAGCATCACCACAGGATTGGGGCGTCGAATTTTCGGATCGCTCTGGACCGGGATTGCATTGCTGTGCTGCATCAGAGCATGTGCAGGCACCA[C/A]
AAGAGTCCGTGCCGCAGCAAGTGGCTTCCTCAACCTGACTTGGCCTGTATTCTTCTTGCAGTTCACTGTGATTATGCTTCTGTGTTTCCTTTGCTACAAC

Reverse complement sequence

GTTGTAGCAAAGGAAACACAGAAGCATAATCACAGTGAACTGCAAGAAGAATACAGGCCAAGTCAGGTTGAGGAAGCCACTTGCTGCGGCACGGACTCTT[G/T]
TGGTGCCTGCACATGCTCTGATGCAGCACAGCAATGCAATCCCGGTCCAGAGCGATCCGAAAATTCGACGCCCCAATCCTGTGGTGATGCTACTCATCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 17.20% 0.08% 0.00% NA
All Indica  2759 72.20% 27.60% 0.14% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 86.60% 13.40% 0.00% 0.00% NA
Indica I  595 81.50% 18.00% 0.50% 0.00% NA
Indica II  465 76.60% 23.40% 0.00% 0.00% NA
Indica III  913 61.00% 38.90% 0.11% 0.00% NA
Indica Intermediate  786 75.70% 24.30% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421592215 C -> A LOC_Os04g35480.1 missense_variant ; p.Cys518Phe; MODERATE nonsynonymous_codon ; C518F Average:79.858; most accessible tissue: Callus, score: 91.309 benign 0.271 TOLERATED 0.15

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421592215 C A -0.04 -0.06 -0.04 0.03 -0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421592215 6.62E-06 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421592215 8.40E-06 NA mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421592215 9.27E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421592215 2.41E-06 NA mr1111 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421592215 5.03E-06 NA mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421592215 2.77E-06 NA mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421592215 7.66E-06 NA mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251