Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421466152:

Variant ID: vg0421466152 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21466152
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTGACGTTTGGAGTATTAAGATTAGTACTGCCTTCAACGTCAAATATTATTGACTGAAGGGAGTATATAATCCCGTATGTGAATTCTAGCTGACGTA[C/T]
TGATTTGAGTCCAAAAACATGTGTGACCTCCAACATTTCCGACAGATTGGCAGATTGCACATCTCTACAAATAATCTGAAAACTAAAAAAGAATATGACC

Reverse complement sequence

GGTCATATTCTTTTTTAGTTTTCAGATTATTTGTAGAGATGTGCAATCTGCCAATCTGTCGGAAATGTTGGAGGTCACACATGTTTTTGGACTCAAATCA[G/A]
TACGTCAGCTAGAATTCACATACGGGATTATATACTCCCTTCAGTCAATAATATTTGACGTTGAAGGCAGTACTAATCTTAATACTCCAAACGTCAAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.50% 15.70% 3.79% 0.00% NA
All Indica  2759 71.90% 23.90% 4.17% 0.00% NA
All Japonica  1512 92.70% 3.60% 3.64% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 51.10% 37.60% 11.26% 0.00% NA
Indica II  465 37.40% 56.80% 5.81% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 76.20% 21.10% 2.67% 0.00% NA
Temperate Japonica  767 94.00% 0.40% 5.61% 0.00% NA
Tropical Japonica  504 90.10% 9.30% 0.60% 0.00% NA
Japonica Intermediate  241 94.20% 2.10% 3.73% 0.00% NA
VI/Aromatic  96 82.30% 15.60% 2.08% 0.00% NA
Intermediate  90 80.00% 12.20% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421466152 C -> T LOC_Os04g35290.1 upstream_gene_variant ; 1108.0bp to feature; MODIFIER silent_mutation Average:77.951; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0421466152 C -> T LOC_Os04g35300.1 downstream_gene_variant ; 333.0bp to feature; MODIFIER silent_mutation Average:77.951; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0421466152 C -> T LOC_Os04g35305.1 downstream_gene_variant ; 2828.0bp to feature; MODIFIER silent_mutation Average:77.951; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0421466152 C -> T LOC_Os04g35290-LOC_Os04g35300 intergenic_region ; MODIFIER silent_mutation Average:77.951; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421466152 C T -0.08 -0.01 0.0 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421466152 NA 1.07E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 9.93E-11 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 1.47E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 1.09E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 5.47E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 8.91E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 2.07E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 7.51E-10 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 2.49E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 1.16E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 8.70E-07 NA mr1078_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 9.03E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 1.56E-11 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 1.91E-06 NA mr1094_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 5.73E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 5.56E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 5.76E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 2.40E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 5.83E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 4.92E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 2.44E-12 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 7.03E-06 mr1172_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 9.87E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 6.82E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 1.70E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 2.39E-06 NA mr1610_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421466152 NA 6.95E-07 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251