Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421455278:

Variant ID: vg0421455278 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21455278
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAAATTCTGAGAAGCAGCTGGTTGGTAGCTAGCTTCTAAGAATCTAGAAAAAAGCTGGGTTTTTCAGTTTCTGATTTCTAGTTCATTTTCTGGATTCTA[C/T]
ATCTACAGCTTCTAAGAATCTAGTCTAAAAGCTGGACTATTTGAGGAAACTTCTAATTCTGGGTAAAGTTGCAGCAGCTAAAAGCTCCTCCAAACAGACC

Reverse complement sequence

GGTCTGTTTGGAGGAGCTTTTAGCTGCTGCAACTTTACCCAGAATTAGAAGTTTCCTCAAATAGTCCAGCTTTTAGACTAGATTCTTAGAAGCTGTAGAT[G/A]
TAGAATCCAGAAAATGAACTAGAAATCAGAAACTGAAAAACCCAGCTTTTTTCTAGATTCTTAGAAGCTAGCTACCAACCAGCTGCTTCTCAGAATTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 13.90% 0.08% 0.34% NA
All Indica  2759 80.60% 18.70% 0.14% 0.58% NA
All Japonica  1512 96.80% 3.20% 0.00% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 81.30% 17.80% 0.34% 0.50% NA
Indica II  465 93.10% 5.80% 0.22% 0.86% NA
Indica III  913 71.40% 28.30% 0.11% 0.22% NA
Indica Intermediate  786 83.20% 15.90% 0.00% 0.89% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 91.50% 8.50% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421455278 C -> DEL N N silent_mutation Average:81.993; most accessible tissue: Minghui63 young leaf, score: 91.842 N N N N
vg0421455278 C -> T LOC_Os04g35280.1 intron_variant ; MODIFIER silent_mutation Average:81.993; most accessible tissue: Minghui63 young leaf, score: 91.842 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421455278 C T 0.0 0.0 0.0 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421455278 NA 1.19E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421455278 NA 2.69E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421455278 NA 2.22E-07 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421455278 9.05E-06 1.63E-08 mr1192 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421455278 NA 6.99E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251