| Variant ID: vg0421407009 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 21407009 |
| Reference Allele: TA | Alternative Allele: AA,TAAAA,TAAA,T |
| Primary Allele: AA | Secondary Allele: TA |
Inferred Ancestral Allele: Not determined.
TACACATAAACTTCTAACTTTTCTATCACATCATCTCAATTTCAATTAAACTTCTAATTTTAGCATGGAATAAACACATCCAAAGTTATTGTTTTTTTTT[TA/AA,TAAAA,TAAA,T]
AAAAAAATTGTACTATGAATAGGCAGGGAGTGATTGAAGTATGTTCAGTTCACTGGCATCCTCCGCTGACTAATTATCCAACGGATTATATAAAGTGGAT
ATCCACTTTATATAATCCGTTGGATAATTAGTCAGCGGAGGATGCCAGTGAACTGAACATACTTCAATCACTCCCTGCCTATTCATAGTACAATTTTTTT[TA/TT,TTTTA,TTTA,A]
AAAAAAAAACAATAACTTTGGATGTGTTTATTCCATGCTAAAATTAGAAGTTTAATTGAAATTGAGATGATGTGATAGAAAAGTTAGAAGTTTATGTGTA
| Populations | Population Size | Frequency of AA(primary allele) | Frequency of TA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.20% | 21.40% | 8.78% | 8.99% | TAAAA: 4.27%; TAAA: 3.17%; T: 0.15% |
| All Indica | 2759 | 49.10% | 16.20% | 8.48% | 14.43% | TAAAA: 7.21%; TAAA: 4.35%; T: 0.14% |
| All Japonica | 1512 | 63.40% | 26.50% | 10.12% | 0.00% | NA |
| Aus | 269 | 33.10% | 45.00% | 5.58% | 6.32% | TAAA: 10.04% |
| Indica I | 595 | 59.30% | 13.90% | 14.45% | 9.58% | TAAAA: 1.68%; T: 0.50%; TAAA: 0.50% |
| Indica II | 465 | 65.60% | 8.40% | 9.68% | 14.84% | TAAAA: 1.29%; TAAA: 0.22% |
| Indica III | 913 | 35.20% | 21.70% | 5.15% | 17.96% | TAAAA: 11.39%; TAAA: 8.65% |
| Indica Intermediate | 786 | 48.00% | 16.30% | 7.12% | 13.74% | TAAAA: 10.05%; TAAA: 4.71%; T: 0.13% |
| Temperate Japonica | 767 | 58.10% | 27.20% | 14.60% | 0.00% | NA |
| Tropical Japonica | 504 | 83.30% | 11.50% | 5.16% | 0.00% | NA |
| Japonica Intermediate | 241 | 38.60% | 55.20% | 6.22% | 0.00% | NA |
| VI/Aromatic | 96 | 56.20% | 25.00% | 5.21% | 7.29% | TAAA: 3.12%; T: 2.08%; TAAAA: 1.04% |
| Intermediate | 90 | 62.20% | 22.20% | 8.89% | 3.33% | TAAAA: 2.22%; T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421407009 | TA -> DEL | N | N | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> TAAAA | LOC_Os04g35220.1 | upstream_gene_variant ; 1625.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> TAAAA | LOC_Os04g35230.1 | upstream_gene_variant ; 1496.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> TAAAA | LOC_Os04g35220.2 | upstream_gene_variant ; 1625.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> TAAAA | LOC_Os04g35220-LOC_Os04g35230 | intergenic_region ; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> AA | LOC_Os04g35220.1 | upstream_gene_variant ; 1623.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> AA | LOC_Os04g35230.1 | upstream_gene_variant ; 1498.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> AA | LOC_Os04g35220.2 | upstream_gene_variant ; 1623.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> AA | LOC_Os04g35220-LOC_Os04g35230 | intergenic_region ; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> TAAA | LOC_Os04g35220.1 | upstream_gene_variant ; 1625.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> TAAA | LOC_Os04g35230.1 | upstream_gene_variant ; 1496.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> TAAA | LOC_Os04g35220.2 | upstream_gene_variant ; 1625.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> TAAA | LOC_Os04g35220-LOC_Os04g35230 | intergenic_region ; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> T | LOC_Os04g35220.1 | upstream_gene_variant ; 1624.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> T | LOC_Os04g35230.1 | upstream_gene_variant ; 1497.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> T | LOC_Os04g35220.2 | upstream_gene_variant ; 1624.0bp to feature; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| vg0421407009 | TA -> T | LOC_Os04g35220-LOC_Os04g35230 | intergenic_region ; MODIFIER | silent_mutation | Average:72.483; most accessible tissue: Callus, score: 93.685 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421407009 | NA | 3.71E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 4.83E-07 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 3.04E-09 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 8.38E-07 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 8.84E-07 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 6.16E-09 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 1.05E-07 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 9.57E-09 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 3.37E-07 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 5.75E-10 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 1.76E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 2.05E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 8.72E-06 | mr1066_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 1.69E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | 4.28E-06 | NA | mr1403_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 9.82E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 1.08E-06 | mr1657_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 1.68E-06 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421407009 | NA | 7.17E-06 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |