| Variant ID: vg0421391589 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21391589 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )
AAACCAGACGATTTACCCACCTTGACCCAATCCATAGTGATTTTGTCCAACGTGGCGCACACGTGGCAATCCAGTCAATGTTTTTTTAATAAAAAATTGT[G/A]
GGACCCGCATGTCATCTCTTCTTCCTCTCTCTACTCTCTCTCGCTCTTTTCTCTCTCACGCAGTGCACACGGCGAGGACGGGCAGTGGGCGTGGTCAGTT
AACTGACCACGCCCACTGCCCGTCCTCGCCGTGTGCACTGCGTGAGAGAGAAAAGAGCGAGAGAGAGTAGAGAGAGGAAGAAGAGATGACATGCGGGTCC[C/T]
ACAATTTTTTATTAAAAAAACATTGACTGGATTGCCACGTGTGCGCCACGTTGGACAAAATCACTATGGATTGGGTCAAGGTGGGTAAATCGTCTGGTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 2.60% | 0.91% | 13.97% | NA |
| All Indica | 2759 | 77.60% | 0.30% | 0.11% | 21.96% | NA |
| All Japonica | 1512 | 89.70% | 5.40% | 2.51% | 2.38% | NA |
| Aus | 269 | 95.20% | 1.50% | 0.37% | 2.97% | NA |
| Indica I | 595 | 84.50% | 0.00% | 0.17% | 15.29% | NA |
| Indica II | 465 | 80.60% | 0.00% | 0.00% | 19.35% | NA |
| Indica III | 913 | 70.40% | 0.80% | 0.22% | 28.59% | NA |
| Indica Intermediate | 786 | 78.90% | 0.30% | 0.00% | 20.87% | NA |
| Temperate Japonica | 767 | 98.20% | 0.30% | 1.04% | 0.52% | NA |
| Tropical Japonica | 504 | 92.50% | 4.20% | 1.98% | 1.39% | NA |
| Japonica Intermediate | 241 | 57.30% | 24.10% | 8.30% | 10.37% | NA |
| VI/Aromatic | 96 | 71.90% | 25.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 85.60% | 5.60% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421391589 | G -> DEL | N | N | silent_mutation | Average:57.809; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg0421391589 | G -> A | LOC_Os04g35200.1 | upstream_gene_variant ; 3997.0bp to feature; MODIFIER | silent_mutation | Average:57.809; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg0421391589 | G -> A | LOC_Os04g35200-LOC_Os04g35210 | intergenic_region ; MODIFIER | silent_mutation | Average:57.809; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421391589 | 3.20E-09 | 2.47E-11 | mr1113 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421391589 | NA | 3.87E-09 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421391589 | NA | 8.97E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421391589 | 1.06E-06 | 4.50E-11 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421391589 | NA | 7.08E-11 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421391589 | 1.91E-06 | 2.22E-09 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421391589 | NA | 2.00E-07 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421391589 | 1.90E-06 | 3.27E-11 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421391589 | NA | 7.98E-08 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421391589 | 6.75E-08 | 1.68E-14 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/