Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421390453:

Variant ID: vg0421390453 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21390453
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCCGGCGACAAGCATTATCGCCCTTCCTCCTATGTTATTTGCTTACTCAATTTAACACTACTTCTATTCATACTTTTTTGAACTTTAAAAATTAGGCC[T/C]
TATAGTTTTTAGAATTCATTGTCTTGTTGGCTTTCATTTTCAAAATTTTTAGAAGTATCGTCAAACATCGCCAATTTACTATTCTACGACTCGTCCACTG

Reverse complement sequence

CAGTGGACGAGTCGTAGAATAGTAAATTGGCGATGTTTGACGATACTTCTAAAAATTTTGAAAATGAAAGCCAACAAGACAATGAATTCTAAAAACTATA[A/G]
GGCCTAATTTTTAAAGTTCAAAAAAGTATGAATAGAAGTAGTGTTAAATTGAGTAAGCAAATAACATAGGAGGAAGGGCGATAATGCTTGTCGCCGGGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 2.60% 2.41% 4.57% NA
All Indica  2759 91.70% 0.60% 3.26% 4.49% NA
All Japonica  1512 88.60% 4.90% 0.60% 5.95% NA
Aus  269 94.40% 1.50% 3.72% 0.37% NA
Indica I  595 96.60% 0.00% 1.68% 1.68% NA
Indica II  465 93.80% 0.00% 2.37% 3.87% NA
Indica III  913 88.00% 1.20% 4.27% 6.57% NA
Indica Intermediate  786 91.00% 0.60% 3.82% 4.58% NA
Temperate Japonica  767 97.50% 0.80% 0.39% 1.30% NA
Tropical Japonica  504 92.10% 4.40% 0.00% 3.57% NA
Japonica Intermediate  241 52.70% 19.10% 2.49% 25.73% NA
VI/Aromatic  96 71.90% 25.00% 3.12% 0.00% NA
Intermediate  90 92.20% 4.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421390453 T -> C LOC_Os04g35200.1 upstream_gene_variant ; 2861.0bp to feature; MODIFIER silent_mutation Average:46.141; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0421390453 T -> C LOC_Os04g35200-LOC_Os04g35210 intergenic_region ; MODIFIER silent_mutation Average:46.141; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0421390453 T -> DEL N N silent_mutation Average:46.141; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421390453 3.56E-07 3.56E-07 mr1098 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 2.24E-06 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 2.75E-07 3.06E-09 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 1.01E-07 2.45E-11 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 4.65E-07 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 1.99E-07 3.00E-12 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 6.05E-06 1.51E-11 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 4.46E-07 4.00E-10 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 7.12E-09 2.92E-11 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 1.65E-09 1.40E-14 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 1.49E-06 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 3.32E-06 3.32E-06 mr1197 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 1.17E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 1.46E-08 1.01E-15 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 9.53E-10 1.10E-13 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 5.57E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 1.43E-08 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 6.35E-06 1.39E-10 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 1.04E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 8.04E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 1.62E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 5.80E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 6.44E-07 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 9.89E-07 mr1098_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 5.27E-08 1.70E-11 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 3.75E-10 8.12E-15 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 8.55E-11 6.56E-16 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 1.02E-09 3.49E-15 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 9.38E-10 8.65E-15 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 4.96E-09 5.69E-13 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 9.09E-11 6.74E-16 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 1.94E-06 2.04E-08 mr1150_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 2.03E-11 1.48E-17 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 2.49E-09 2.84E-15 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 2.13E-09 8.76E-14 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 4.01E-09 9.30E-14 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 8.27E-11 3.62E-17 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 4.09E-07 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 1.42E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 NA 3.16E-08 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421390453 5.51E-09 8.54E-13 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251