Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421366980:

Variant ID: vg0421366980 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21366980
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TTGACATATAAAGCAATATGAGGATGGAACCTACATGCCACTGACTGTAATGTTAGTGCAATATGCGATGTTTAGTTCCCAAACAAAAACTTTTCACCCT[G/A]
TCACATCGAATGTTTGGACACATACATAGAATATTAAATATAGACAAAAAAAACTAATTACACAGATTGCGTGTAAATTGCAAGACGAATCTTTTAAGTC

Reverse complement sequence

GACTTAAAAGATTCGTCTTGCAATTTACACGCAATCTGTGTAATTAGTTTTTTTTGTCTATATTTAATATTCTATGTATGTGTCCAAACATTCGATGTGA[C/T]
AGGGTGAAAAGTTTTTGTTTGGGAACTAAACATCGCATATTGCACTAACATTACAGTCAGTGGCATGTAGGTTCCATCCTCATATTGCTTTATATGTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 18.30% 0.08% 0.04% NA
All Indica  2759 68.90% 30.90% 0.14% 0.07% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 66.60% 33.10% 0.17% 0.17% NA
Indica II  465 73.10% 26.70% 0.00% 0.22% NA
Indica III  913 66.50% 33.50% 0.00% 0.00% NA
Indica Intermediate  786 71.00% 28.60% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421366980 G -> DEL N N silent_mutation Average:58.71; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg0421366980 G -> A LOC_Os04g36640.1 upstream_gene_variant ; 1593.0bp to feature; MODIFIER silent_mutation Average:58.71; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg0421366980 G -> A LOC_Os04g35160.1 upstream_gene_variant ; 1546.0bp to feature; MODIFIER silent_mutation Average:58.71; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg0421366980 G -> A LOC_Os04g35140.1 downstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:58.71; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg0421366980 G -> A LOC_Os04g36640-LOC_Os04g35160 intergenic_region ; MODIFIER silent_mutation Average:58.71; most accessible tissue: Minghui63 root, score: 77.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421366980 8.04E-06 8.04E-06 mr1267_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 NA 5.09E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 5.23E-06 5.23E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 NA 1.46E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 NA 5.10E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 NA 1.51E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 5.27E-06 NA mr1657_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 9.68E-07 7.34E-08 mr1657_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 NA 6.55E-07 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 NA 2.28E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 3.35E-06 3.35E-06 mr1674_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 NA 3.61E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 4.33E-06 4.33E-06 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980 6.39E-06 6.38E-06 mr1822_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251