Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421352088:

Variant ID: vg0421352088 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21352088
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGCAGAGCTGTGGCAAATATTATGGTTATGGCCGAGTTTAGTTCCAAACTTTTTCTAAAACTTTCAACTTTTCCATCACATCAAAATTTTCCTATACA[T/C,A]
AAACTTCCAATTTTTTCGTCACATCGTTTTAATTTCAACCAAACTTCTAATTTTTGCATGAACTAAACACACCCTACGAATCTTAGCTGCTAAGTTTCAG

Reverse complement sequence

CTGAAACTTAGCAGCTAAGATTCGTAGGGTGTGTTTAGTTCATGCAAAAATTAGAAGTTTGGTTGAAATTAAAACGATGTGACGAAAAAATTGGAAGTTT[A/G,T]
TGTATAGGAAAATTTTGATGTGATGGAAAAGTTGAAAGTTTTAGAAAAAGTTTGGAACTAAACTCGGCCATAACCATAATATTTGCCACAGCTCTGCTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 48.90% 0.23% 0.13% A: 0.38%
All Indica  2759 63.70% 35.10% 0.29% 0.22% A: 0.65%
All Japonica  1512 20.30% 79.60% 0.13% 0.00% NA
Aus  269 75.10% 24.50% 0.37% 0.00% NA
Indica I  595 70.80% 28.70% 0.34% 0.17% NA
Indica II  465 71.40% 25.20% 0.22% 0.65% A: 2.58%
Indica III  913 55.80% 44.00% 0.11% 0.00% A: 0.11%
Indica Intermediate  786 63.10% 35.50% 0.51% 0.25% A: 0.64%
Temperate Japonica  767 14.20% 85.50% 0.26% 0.00% NA
Tropical Japonica  504 15.30% 84.70% 0.00% 0.00% NA
Japonica Intermediate  241 50.20% 49.80% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421352088 T -> C LOC_Os04g35130.1 intron_variant ; MODIFIER silent_mutation Average:88.078; most accessible tissue: Zhenshan97 flower, score: 96.906 N N N N
vg0421352088 T -> DEL N N silent_mutation Average:88.078; most accessible tissue: Zhenshan97 flower, score: 96.906 N N N N
vg0421352088 T -> A LOC_Os04g35130.1 intron_variant ; MODIFIER silent_mutation Average:88.078; most accessible tissue: Zhenshan97 flower, score: 96.906 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421352088 T A -0.01 -0.02 0.0 -0.01 -0.01 0.0
vg0421352088 T C -0.02 -0.02 -0.02 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421352088 NA 1.58E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 2.89E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 2.61E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 1.87E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 9.65E-06 4.14E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 3.37E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 7.90E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 3.90E-09 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 2.56E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 5.22E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 9.91E-08 9.91E-08 mr1267_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 9.76E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 6.72E-06 6.72E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 1.53E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 3.58E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 5.47E-06 NA mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 4.63E-08 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 5.90E-06 mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 8.63E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 1.55E-06 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 3.03E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 8.83E-07 mr1595_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 5.75E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 5.32E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 6.17E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 7.00E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 3.51E-06 3.51E-06 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 5.65E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 3.71E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 9.91E-06 mr1757_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 8.58E-06 mr1766_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 3.62E-06 3.62E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 3.23E-06 1.52E-06 mr1952_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 4.67E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421352088 NA 7.33E-06 mr1986_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251